| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biochemistry, Molecular Biology, and Cell Biology, Northwestern University, Evanston, Illinois.
| Correspondence to: Dr HuangHui Tang, Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern University, Evanston, IL 60208 (e-mail: h-tang2{at}northwestern.edu). |
| Received for publication May 7, 2008; accepted for publication October 15, 2008. |
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Key words: DNA methylation, cancer/testis antigen, promoter
By screening a repertoire composed of 22 cancer cell lines, 2 melanoma lines were identified that express hLdhc. These cell lines provided a useful tool to characterize the promoter of hLdhc and to obtain an understanding of the regulatory mechanism for its ectopic expression in cancers. Previously, data describing the hLdhc promoter were obtained with a cell-free in vitro transcription assay (Bonny et al, 1998); the transcription factor Sp1 was reported to play a major role in hLdhc expression. In addition and unlike the murine promoter, the proximal region of the human 5' genomic sequence was found to contain a mini–CpG island (CGI). A CGI is a stretch of CpG dinucleotides sequestered within a short genomic DNA region, with the CpG dinucleotides as the target for DNA methylation. The activation of several human CTAs in tumor cells is reported to correlate with CGI hypomethylation in the gene promoter sequence (De Smet et al, 1999, 2004; Lim et al, 2005). Therefore, the role of CGI methylation in regulation of hLdhc gene expression was investigated in the melanoma cell lines in this study. Also, we took the opportunity to investigate prostate tumor tissues in view of a recent clinical study showing a correlation between gene regulatory region methylation and Gleason score, pathologic stage, and tumor occurrence of prostate cancer. CGI methylation was suggested to serve as a molecular biomarker for the detection and diagnosis of patients with prostate cancer (Bastian et al, 2004). Ellinger et al (2008) demonstrated that hypermethylation at a single locus did not correlate with any clinicopathologic variables; however, hypermethylation in promoters of 2 genes was significantly correlated with the pathologic stage and/or Gleason score. In this study the hLdhc CGI methylation level was examined in a small number of prostate cancer patients to evaluate its role as a potential biomarker. We report here that a 110-bp core promoter was able to drive robust reporter expression in cancer cells that express hLdhc, and that both the GC box and the CRE site in the core promoter are essential for basal promoter activity. In addition, promoter CGI methylation plays a role in controlling hLdhc expression in cancer cells.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Reverse Transcription–Polymerase Chain Reaction
Total RNA was extracted using TRIzol (Invitrogen) reagent. Two micrograms
total RNA was used to synthesize first-strand cDNA by M-MLV reverse
transcriptase (RT; Promega) according to the manufacturer's instructions. For
hLdhc amplification, 1 µl RT product was used in 25 µl
RT–polymerase chain reaction (PCR) mixture; PCR primers were
5'-GTCGTTGGTGTATTTTTCTGGTGTCA-3' (sense) and
5'-CACAGCCTGCTATCTTCTGTTCTCC-3' (antisense). PCR conditions were 1
minute at 94°C, 31 cycles of 15 seconds at 94°C, 30 seconds at
58°C, and 1 minute 30 seconds at 72°C. For human β-actin control,
0.5 µl RT product was used in 25 µl RT-PCR mixture; PCR primers were
5'-TGACGGGGTCACCCACACTGTGC CCATCTA-3' (sense) and
5'-CTAGAAGCATTTGCGGTGGACGATGGA GGG-3' (antisense); PCR conditions
were 1 minute at 94°C, 25 cycles of 15 seconds at 94°C, 30 seconds at
63°C, and 1 minute 30 seconds at 72°C. The cycle number was adjusted
for PCR amplification in the linear range. PCR products were run on an agarose
gel, then stained by SYBR Green (Molecular Probes, Eugene, Oregon) for 30
minutes and imaged with a Kodak (Rochester, New York) Image Station 4000
System; for quantitative analysis and comparison of mRNA levels, Kodak
Molecular Imaging software 4.0 was applied to obtain the net intensity for
region of interest in the same gel. β-actin was used as a control for
cDNA loading.
Plasmid Constructs
Primers Used for Constructs—
Forward primers carry a KpnI restriction site and reverse primer a HindIII
restriction site for all human promoter constructs. hldhc5'793F:
5'-ATGGTACCCTACCTGTAATGGAAAGCCACGGAAG-3' (construct
–1718/+22); hldhcSeqF: 5'-ATGGTACC CGCTCCAGGGCAGAA AAGAC-3'
(construct –502/+22); hldhc148F:
5'-ATGGTACCACGGAGGGCAACCGTCGAC-3' (construct –393/+22);
hldhc265F: 5'-ATGGTACCTGATTGCGCCAAGCAAAGC-3' (construct
–278/+22); hldhc364F: 5'-ATGGTACCTCCCATTGCCTGGTAGACT-3'
(construct –180/+22); hldhc452F:
5'-ATGGTACCGGCTCCAACATTCTGCAAACTG-3' (construct –92/+22).
Common reverse primer is hldhc5'LR2: 5'-CATAAGCTTGCTGCTCCTTGACAG
TTGACATTTGGAGAAC-3'; human blood genomic DNA (Promega) was used as
template to amplify the region of interest by Pfu polymerase (Stratagene, La
Jolla, California). PCR products were purified on agarose gel and digested by
restriction enzyme pair (KpnI/HindIII) and cloned into the pGL4-luc2
(Promega).
Primers Used for Deletion Constructs— Common forward primer was hldhcSeqF; reverse primer is shown as follows: hldhc148Re: 5'-CATAAGCTTCGACTCGAGACACGCACG-3' (construct –502/–393); hldhc265Re: 5'-CATAAGCTTTACAGATGACCCACAGGGAC-3' (construct –502/–278); hldhc364Re: 5'-CATAAGCTTGCTGGGGCACCAGCG-3' (construct –502/–180); hldhc474Re: 5'-CATAAGCTTCAGTTTGCAGAATGTTGGAGC-3' (construct –502/–92). A short 40-bp human ldhc promoter (–462/–422) construct was prepared by cloning an annealed synthetic oligonucleotide pair hLdhc40promoterS (5'-CGGCGGGGGGCGGAGCTTGCGTGCTGAC GGGGCGGAGCTTGCGTGCTGACGCATAAGAGCCA-3') and hLdhc40promoterAS (5'-AGCTTGGCTCTTATGCGTCAGCACGC AAGCTCCGCCCCCCGCCGGTAC-3') into pGL4-luc2 vector. Three mutated promoter constructs were prepared by using an overlapping primer pair that contained mutations in either GC box or cyclic adenosine monophosphate–responsive element (CRE) sites in the hLdhc core promoter region (–502/–393). For the hSpmu construct, PCR1 (primer hldhcSeqF and hSpmuFor 5'-GGGTTGGAGCTTGCGTGCTG-3') and PCR2 (primer hSpmuRe 5'-ACGCAAGCTCCAACCCCCGCCGGCCCAG-3' and hLdhc148Re) were performed separately, then the PCR products were combined and diluted 200-fold for a further PCR using primers hLdhcSeqF and hLdhc148Re. This final PCR product was digested by KpnI/HindIII, cloned into vector pGL4-luc2, and confirmed by sequencing. A similar procedure was used to create the hCREmu construct by using 2 overlapping primers containing mutation: hCREmuFor 5'-GCGTGCTGTGGCATAAGAGCCGAGCG-3' and hCRE-muRe 5'-CTTATGCCACAGCACGCAAGCTCC-3'. The double mutant construct Sp/CREmu was created by using hSpmu as template, but the PCRs were performed using the primer set for creating hCREmu construct.
Electrophoretic Mobility Shift Assay
The gel shift kit supplied by Promega was used according to the
manufacturer's instructions with the following modifications. The labeled
probe was purified on a G-50 micro column (Amersham Pharmacia, Piscataway, New
Jersey). Electrophoretic mobility shift assay (EMSA) on a 5% 0.75-mm-thick
acrylamide gel was performed in the cold room until the dye front reached the
bottom of the gel. The following oligonucleotides were used for EMSA: GC box
probe hldhc-GC (5'-GGGCCGGCGG GGGGCGGAGCTT-3');
CRE site probe hldhc-CRE
(5'-GCTTGCGTGCTGACGCATAAG-3'); hldhc-GCmu1
(5'-GGGCCGGCGGGGGTTGGAGCT-3'); hldhc-GCmu2
(5'-GGGCCGGCTAGGGGCGGAGCTT-3'); hldhc-CREmu
(GCTTGCGTGCTGTGGCATAAG-3'). Sp1 antibody (sc-59) for
supershifts was purchased from Santa Cruz Biotechnology Inc (Santa Cruz,
California), and antibody recognizing CREB was obtained from Rockland
Immunochemicals (Gilbertsville, Pennsylvania).
Bisulfite Genomic Sequencing
Genomic DNA was extracted from cultured cells or tissue by either DNeasy
Tissue Kit (Qiagen, Valencia, California) or Wizard Genomic DNA Purification
Kit (Promega). The EZ DNA Methylation-Gold kit (Zymo Research, Orange,
California) was used for bisulfite treatment. The PCR amplification procedure
was as described previously (Clark et al,
1994) with the following modifications: Seminested PCR amplified
the CGI region of the hLdhc promoter; the first PCR primer set was
MET600F: 5'GGTTAGGTTGTTTTTAAATTTTTGATTTTAGG and MET1161Re:
5'CAAAAACAAAACACCACCTTTAAA; after the first PCR the reaction was diluted
100 times and 1 µl used for the second PCR amplification. The second PCR
primer set was MET873F: 5'GTTTTGTATATTTTTTGGGTTAGTTTAGAA and MET1161Re.
PCR conditions were 2 minutes at 94°C; 5 cycles of 1 minute at 94°C, 2
minutes at 51°C, and 2 minutes at 72°C; followed by 30 cycles of 30
seconds at 94°C, 2 minutes at 51°C, and 90 seconds at 72°C; with a
final 6-minute extension at 72°C. PCR products were separated on an
agarose gel, excised, and purified by QIAquick Gel Extraction Kit (Qiagen). TA
cloning was used to insert the PCR products into pGEM-T Easy Vector (Promega).
The insert was confirmed by restriction digestion and sequenced with the
T7/SP6 universal primer in the cloning vector. About 10 subclones were picked
for each DNA sample.
Pyrosequencing Analysis
Prostate tumor DNA samples were provided by Dr Karen Kaul's Molecular
Diagnosis Laboratory in Evanston Northwestern Healthcare, Evanston, Illinois.
Prostate samples were obtained from patients according to Prostate Tissue Bank
protocol. Tissue slices were embedded in optimum cutting temperature medium
and frozen, then stored at –80°C. Frozen sections were hematoxylin
and eosin–stained and examined microscopically; tumor percentages were
recorded by a clinical pathologist. Samples for this study were obtained by
cutting three 10-µm sections from each tissue block for DNA extraction and
purification using the Puregene DNA isolation kit (Gentra Systems,
Minneapolis, Minnesota). DNA was treated by the bisulfite modification kit as
mentioned previously. Bisulfite-treated DNA was then amplified by PCR with a
pair of methylation DNA primers; the PCR products were used for pyrosequencing
analysis. The pyrosequencing service was offered by EpigenDx Inc (Worcester,
Massachusetts). The assay design package is available upon request.
Statistical Analysis
Statistical analyses were performed by using GraphPad Prism for Windows
version 4.0 (GraphPad Software Inc, San Diego, California). One-way analysis
of variance and Bonferroni's multiple comparison test were used to evaluate
data. Differences were considered significant when P was less than
.05.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
The C81-61 cultured cells have a low passage number (5) and grow very slowly with low transfection efficiency for plasmid DNA. Therefore the A375M cell line was chosen for characterization of the hLdhc promoter. The 5' proximal promoter sequence of the hLdhc gene is illustrated in Figure 2. Twenty-four CpG dinucleotides were found to sequester in a 200-bp promoter region. Some important transcription factors, including Sp1, CRE, and HIF1, all have binding sites in this region. To identify the core promoter, a progressive 5' deletion of the flanking sequence of hLdhc led to a series of constructs with promoters from 100 bp to 1.7 kb of DNA (Figure 3). All the tested promoter fragments have a common 3' end (position +22). These constructs were used for transient transfection of the A375M melanoma cell line. Reporter luciferase activity was not significantly different between construct –1718/+22 and –502/+22 (P > .05), indicating that the first 1.2 kb fragment (from position –1718 to –502) does not contribute to the promoter activity. However, a further 100-bp deletion (region from –502 to –393) resulted in a more than 10-fold reduction of reporter activity (P < .001). Any further deletion did not seem to affect activity, indicating that the region from –502 to –393 is essential for hLdhc promoter activity (Figure 3). Next we asked whether downstream cis element(s) are required for promoter activity when the core region (–502 to –393) is retained. All of the promoter sequences for the 5 constructs in this assay have a common 5' start position –502 (Figure 4). However, compared to the core promoter construct (–502/–393), activity did not increase when the length of the sequence was increased stepwise to the translation start site. In contrast, reporter activity decreased significantly (P < .05), suggesting negative regulatory elements embedded in the region from position –393 to +22.
|
|
|
In the 110-bp core promoter region, a GC box and a CRE binding site were identified adjacent to each other (Figure 5). A 2-bp mutation in the GC box (hSpmu) or CRE site (hCREmu) caused an 87% and a 91% reduction in promoter activity, whereas a double mutation Sp/CREmu abolished promoter activity. To test whether a GC box and CRE site were sufficient for core promoter activity, a 40-bp promoter construct (construct –462/–422) containing the pure GC box and CRE site was prepared (Figure 5). However, the reporter activity from this 40-bp promoter was only 25% of that from the 100-bp core promoter (P < .001).
|
A gel shift assay was performed to examine the specific DNA-protein interactions between GC-box and CRE sites of the hLdhc promoter and DNA binding proteins from the A375M cell nuclear extract (Figure 6). The hLdhc promoter contains a consensus GC box (GGGGCGG) that incidentally is conserved between mouse (Tang et al, 2008) and human, but also an overlapping potential binding site (GGCGGGGGGCGG) for Egr (early growth response) transcription factor family (Egr consensus: GCGGGGGCG). Multiple protein-DNA complexes were identified for the fragment Ldhc-GC that contained a GC box (Figure 6). One hundred–fold cold Ldhc-GC oligonucleotide was able to compete off all the shifted bands. But oligonucleotide Ldhc-GCmu1 with a mutated GC box could partially compete off the shifted bands. Presumably the remaining GC-rich sequence in the potential Egr site is able to bind to GC-box binding protein but with lower affinity. Oligonucleotide Ldhc-GCmu2 contained a mutation in the Egr site but not in the GC box, and was able to completely compete off all the shifted bands because of its intact GC box. A supershift band was observed when Sp1 antibody was added to the reaction. Multiple shift bands were also identified for the Ldhc-CRE probe. One hundred–fold cold Ldhc-CRE oligonucleotides can compete with shifted bands, but the oligonucleotides with a CRE mutation could not compete with the top shift band. Addition of a CREB antibody led to a supershift band. The supershift data indicated that transcription factors Sp1 and CREB in the A375M cell nuclear extracts bind specifically to the GC box and CRE site in hLdhc promoter.
|
A 2-kb 5' genomic DNA sequence of the hLdhc gene was analyzed for CpG dinucleotide distribution (Figure 7) using CpG Island Searcher software (Takai and Jones, 2002). A CGI was located in the core promoter region of the gene; other CpG dinucleotides were scattered upstream and downstream of these sequences. Noncore methylation is frequently observed for various genes, but it does not seem to block gene transcription (Gonzalgo et al, 1998; Deng et al, 1999; Miyakura et al, 2001). Therefore, we focused our attention on the island with 24 CpG dinucleotides sequestered in the 200-bp promoter region (Figure 2). The CGI overlaps with the core promoter region.
|
|
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
In this study we demonstrated that the promoter CGI is hypomethylated only in the cancer cells that express hLdhc. The methylation inhibitor 5'Aza-dC induced hLdhc promoter activity in the cell lines with a hypermethylated CGI. The C81-61/C8161 cells were isolated from a patient with metastatic disease and differ only in passage numbers (14 and 59, respectively). Apparently ectopic expression of hLdhc present in the parental cells was lost with increasing passages by hypermethylation of the promoter; a likely mechanism that silences most nonessential genes in cultured cells (Antequera et al, 1990). Therefore, it is not unusual for a cell line to lose expression of tissue-specific markers as passage number increases. Methylation could be a major reason that directly or indirectly silences gene expression, indirectly by silencing the essential transcription regulators of the target gene or directly by limiting access to transcriptionally important binding sites on the promoter.
The A375P/A375M cell lines were derived from the heterogeneous cell line A375 by sequential IV injection via the tail vein in a nude mouse model. A375P is parentallike and A375M was selected for increased lung metastasis characteristics. The passage numbers were 29 for A375M and 32 for A375P when used for methylation analysis of the hLdhc promoter. Szyf et al (2005) proposed that global hypomethylation in cancer cells is associated with activation by demethylation of metastasis-associated genes. In other words, selection for high metastasis likely favors demethylation. Even though direct evidence is required for such a proposal, a selection toward higher metastasis potential in A375 cells indeed led to a hypomethylated CGI and therefore hLdhc expression in A375M cells.
HLdhc transcription was greatly enhanced by combining 5'Aza-dC and TSA compared with methylation inhibitor treatment alone. Previously, Cameron et al (1999) reported a similar synergistic effect of demethylation and HDAC inhibition in the re-expression of genes silenced in cancer. In a transcriptionally silenced status, the methyl-CpG–binding proteins MeCP1 and MeCP2 bind methylated DNA tightly and associate with a complex composed of transcription repressor mSin3A and HDAC (Jones et al, 1998; Nan et al, 1998); the histones in the chromatin are extensively deacetylated through the action of HDAC. The deacetylated histone leads to chromatin condensation and transcription repression (Jones et al, 2002). Even though both demethylation and acetylation contribute to the reactivation of transcription, methylation seems to be dominant because demethylation is prerequisite for reactivation of gene expression rather than acetylation induced by the HDAC inhibitor. The dominant role of methylation is supported both by hLdhc gene activation data and by results from Cameron et al (1999). However, the general molecular mechanism for the interaction between DNA methylation and histone deacetylation will require further clarification (Jones and Baylin, 2002). Overall, the experimental data suggest that both DNA methylation and histone acetylation of the hLdhc promoter are involved in regulating transcription of this gene in these cancer cells.
The methylation status of the hLdhc promoter was examined in 4 prostate tumor biopsy samples by pyrosequencing analysis (Figure 10). Pyrosequencing offers the most sensitive quantitative analysis of methylation in multiple CpG sites of a CGI (Tost et al, 2003; Mirmohammads et al, 2006). Our data indicated that differential methylation patterns indeed exist in these prostate tumor tissue samples with different degrees of malignancy. A very interesting observation was that the specimens with relatively higher methylation levels (PC14 and PC12) were obtained from patients who had suffered a biochemical relapse. Although many more specimens need to be examined to formally prove a correlation, these results may provide a lead to developing a biomarker based on the methylation status of the hLdhc CGI.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Bastian PJ, Yegnasubramanian S, Palapattu GS, Rogers CG, Lin X, De Marzo AM, Nelson WG. Molecular biomarker in prostate cancer: the role of CpG island hypermethylation. Eur Urol. 2004; 46: 698 –708.[CrossRef][Medline]
Bonny C, Cooker LA, Goldberg E. Deoxyribonucleic acids-protein
interactions and expression of the human testis-specific lactate dehydrogenase
promoter: transcription factor Sp1 plays a major role. Biol
Reprod. 1998;58: 754
–759.
Cameron EE, Bachman KE, Myohanen S, Herman JG, Baylin SB. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat Genet. 1999; 21: 103 –107.[CrossRef][Medline]
Chen YT, Scanlan MJ, Sahin U, Tureci O, Gure AO, Tsang S,
Williamson B, Stockert E, Pfreundschuh M, Old LJ. A testicular antigen
aberrantly expressed in human cancers detected by autologous antibody
screening. Proc Natl Acad Sci U S A. 1997; 94: 1914
–1918.
Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping
of methylated cytosines. Nucleic Acids Res. 1994; 22: 2990
–2997.
De Smet C, Loriot A, Boon T. Promoter-dependent mechanism leading
to selective hypomethylation within the 5' region of gene MAGE-A1 in
tumor cells. Mol Cell Biol. 2004; 24: 4781
–4790.
De Smet C, Lurquin C, Lethe B, Martelange V, Boon T. DNA
methylation is the primary silencing mechanism for a set of germ line- and
tumor-specific genes with a CpG-rich promoter. Mol Cell
Biol. 1999;19: 7327
–7335.
Deng G, Chen A, Hong J, Chae HS, Kim YS. Methylation of CpG in a
small region of the hMLH1 promoter invariably correlates with the absence of
gene expression. Cancer Res. 1999; 59: 2029
–2033.
Ellinger J, Bastian PJ, Jurgan T, Biermann K, Kahl P, Heukamp LC, Wernert N, Muller SC, von Ruecker A. CpG island hypermethylation at multiple gene sites in diagnosis and prognosis of prostate cancer. J Urol. 2008;71: 161 –167.[CrossRef]
Emami KH, Burke TW, Smale ST. Sp1 activation of a TATA-less promoter requires a species-specific interaction involving transcription factor IID. Nucleic Acids Res. 1998; 26: 839 –846.
Gonzalgo ML, Hayashida T, Bender CM, Pao MM, Tsai YC, Gonzales FA,
Nguyen HD, Nguyen TT, Jones PA. The role of DNA methylation in expression of
the p19/p16 locus in human bladder cancer cell lines. Cancer
Res. 1998;58: 1245
–1252.
Hintz M, Goldberg E. Immunohistochemical location of LDH-X during spermatogenesis in mouse testes. Dev Biol. 1977; 57: 375 –384.[CrossRef][Medline]
Jaenisch R, Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet. 2003; 33(suppl): 245 –254.[CrossRef][Medline]
Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002; 3: 415 –428.[Medline]
Jones PL, Veenstra GJC, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J, Wolffe AP. Methylation DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet. 1998; 19: 187 –191.[CrossRef][Medline]
Kalejs M, Erenpreisa J. Cancer/testis antigens and gametogenesis: a review and "brain-storming" session. Cancer Cell Int. 2005;5: 4 .[CrossRef][Medline]
Koslowski M, Tureci O, Bell C, Krause P, Lehr HA, Brunner J, Seitz
G, Nestle FO, Huber C, Sahin U. Multiple splice variants of lactate
dehydrogenase C selectively expressed in human cancer. Cancer
Res. 2002;62: 6750
–6755.
Lim JH, Kim SP, Gabrielson E, Park YB, Park JW, Kwon TK. Activation of human cancer/testis antigen gene, XAGE-1, in tumor cells is correlated with CpG island hypomethylation. Int J Cancer. 2005; 116: 200 –206.[CrossRef][Medline]
Mirmohammads A, Marini A, Nambiar S, Hassan M, Tannapfel A, Ruzicka
T, Hengge UR. Epigenetic silencing of the PTEN gene in melanoma.
Cancer Res. 2006; 66(13): 6546
–6552.
Miyakura Y, Sugano K, Konishi F, Ichikawa A, Maekawa M, Shitoh K, Igarashi S, Kotake K, Koyama Y, Nagai H. Extensive methylation of hMLH1 promoter region predominates in proximal colon cancer with microsatellite instability. Gastroenterology. 2001; 121: 1300 –1309.[CrossRef][Medline]
Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature. 1998; 393: 386 –389.[CrossRef][Medline]
Old LJ. Cancer/testis (CT) antigens—a new link between gametogenesis and cancer. Cancer Immun. 2001; 1: 1 .[Medline]
Shim H, Dolde C, Lewis BC, Wu CS, Dang G, Jungmann RA, Dalla-Favera
R, Dang CV. c-Myc transactivation of LDH-A: implications for tumor metabolism
and growth. Proc Natl Acad Sci U S A. 1997; 94: 6658
–6663.
Somboonthum P, Ohta H, Yamada S, Onishi M, Ike A, Nishimune Y,
Nozaki M. cAMP-responsive element in TATA-less core promoter is essential for
haploid-specific gene expression in mouse testis. Nucleic Acids
Res. 2005;33: 3401
–3411.
Szyf M, Campbell PM, Detich N, Ou JN, Hamm S, Bovenzi V. The role of active demethylation in cancer and its therapeutic potential. In: Szyf M ed. DNA Methylation and Cancer Therapy. New York, NY: Springer-Verlag; 2005: 255.
Takai D, Jones PA. Comprehensive analysis of CpG islands in human
chromosomes 21 and 22. Proc Natl Acad Sci U S A. 2002; 99: 3740
–3745.
Tang HH, Kung A, Goldberg E. Regulation of murine lactate
dehydrogenase C (Ldhc) gene expression. Biol Reprod. 2008; 78: 455
–461.
Tost J, Dunker J, Glynne Gut Y. Analysis and quantification of multiple methylation variable positions in CpG islands by PyrosequencingTM. Biotechniques. 2003; 35: 152 –156.[Medline]
van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen E,
Van den EB, Knuth A, Boon T. A gene encoding an antigen recognized by
cytolytic T lymphocytes on a human melanoma. Science. 1991; 254: 1643
–1647.
Weis L, Reinberg D. Accurate positioning of RNA polymerase II on a
natural TATA-less promoter is independent of TATA-binding-protein-associated
factors and initiator-binding proteins. Mol Cell Biol. 1997; 17: 2973
–2984.
Zendman AJ, Ruiter DJ, Van Muijen GNP. Cancer/testis-associated genes: identification, expression profile, and putative function. J Cell Physiol. 2003;194: 272 –288.[CrossRef][Medline]
Zlatanova J, Caiafa P, Van Holde K. Linker histone binding and
displacement: versatile mechanism for transcription regulation.
FASEB J. 2000;14: 1697
–1704.
This article has been cited by other articles:
|
|
 |
|
  E. Goldberg, E. M. Eddy, C. Duan, and F. Odet LDHC: The Ultimate Testis-Specific Gene J Androl, January 1, 2010; 31(1): 86 - 94. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
