Journal of Andrology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published-Ahead-of-Print October 31, 2007, DOI:10.2164/jandrol.107.002758
Journal of Andrology, Vol. 29, No. 2, March/April 2008
Copyright © American Society of Andrology
DOI: 10.2164/jandrol.107.002758

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
29/2/153    most recent
Author Manuscript (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kondo, Y.
Right arrow Articles by Fujisawa, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kondo, Y.
Right arrow Articles by Fujisawa, M.

Oral Administration of Tetrahydrobiopterin Attenuates Testicular Damage by Reducing Nitric Oxide Synthase Activity in a Cryptorchid Mouse Model

YUTAKA KONDO*, TOMOMOTO ISHIKAWA*, KOHEI YAMAGUCHI*, TOYOTAKA YADA{dagger} AND MASATO FUJISAWA*

From the * Division of Urology, Department of Organ Therapeutics, Faculty of Medicine, University Graduate School of Medicine, Kobe, Japan; and the {dagger} Department of Medical Engineering and Systems Cardiology, Kawasaki Medical School, Kurashiki, Japan.

Correspondence to: Dr Yutaka Kondo, 7-5-2 Kusunoki-cho, Chuo-ku, Kobe, Hyogo, 650-0017, Japan (e-mail: ykondo{at}med.kobe-u.ac.jp).
Received for publication February 25, 2007; accepted for publication September 4, 2007.

   Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Experimental cryptorchidism has been shown to induce germ cell apoptosis. Nitric oxide (NO), a ubiquitous free radical produced by NO synthases (NOSs), has been associated with apoptosis in a number of cell types. However, the regulation of NOSs in experimental cryptorchid testes remains unknown. Tetrahydrobiopterin (BH4), an essential cofactor of NOS, plays an important role in the generation of NO. It has been reported that activation of the immune system stimulates an increase in endogenous BH4 rate-limiting enzyme GTP cyclohydrolase I (GTPCH I) activity, resulting in an increase in intracellular BH4 levels and BH4-dependent NO synthesis in various cells. We examined the effect of dietary treatment with BH4 on GTPCH I, BH4 synthesis, NO production, and testicular damage in cryptorchid model mice. Male mice were treated with oral BH4 starting from age 4 weeks or received standard diet only, and right cryptorchid testes were created surgically at age 10 weeks. The testes were evaluated 0, 3, 5, 7, and 10 days after surgery by assays of testicular weight, BH4 and dihydrobiopterin (oxidized BH4) levels, GTPCH I mRNA levels, NOS protein expression levels, NO concentration, and nitrotyrosine (product of ONOO; determinant of NO-dependent damage) levels. In untreated mice, GTPCH I mRNA and BH4 levels increased and eNOS protein expression, NO concentration, and nitrotyrosine levels increased gradually. BH4 treatment decreased GTPCH I mRNA and BH4 levels, with concomitant reduction of eNOS protein levels, nitrotyrosine levels, and NO concentration, resulting in reduced testicular damage. Our findings demonstrate that supplementation with BH4 could provide a new therapeutic intervention for heat stress–based testicular dysfunction.

     Key words: Tetrahydrobiopterin, cryptorchidism



Nitric oxide (NO), a free radical with a well-described role as an intracellular and intercellular messenger in a number of biologic systems (Nathan, 1992), is formed from L-arginine by nitric oxide synthase (NOS). Three distinct isoforms of NOS have been identified (ie, neural NOS [nNOS], inducible NOS [iNOS], and endothelial NOS [eNOS]). An increase in iNOS protein expression and NO production has been observed in animal models of testicular torsion, and iNOS inhibitor has been shown to protect against testicular injury in ischemia-reperfusion (Shiraishi et al, 2001). Zini et al (1999) reported that in rats, surgically induced cryptorchidism results in increased immunostaining of eNOS in apoptotic germ cells as compared with normal testes. Furthermore, we showed that eNOS transgenic mice had significantly accelerated testicular germ cell apoptosis compared with their wild-type littermates in an experimental cryptorchid model (Ishikawa et al, 2005).

Tetrahydrobiopterin (BH4), an essential cofactor of NOS, plays an important role in the generation of NO (Nathan, 1992). GTP cyclohydrolase I (GTPCH I) is the first-step and rate-limiting enzyme for BH4 biosynthesis in its de novo pathway (Alp and Channon, 2004). It was reported that activation of the immune system results in the production of interferon-{gamma}, which then stimulates an increase in GTPCH I activity in macrophages, resulting in increases in intracellular BH4 levels and BH4-dependent NO synthesis in rodents (Werner et al, 1990). GTPCH I mRNA and BH4 syntheses are also induced by interferon-{gamma} in lymphocytes (Schott et al, 1993); by interleukin-1β in smooth muscle cells (Scott-Burden et al, 1993); and by cytokines in endothelial cells, where it regulates the activity of eNOS (Rosenkranz-Weiss et al, 1994). Administration of bacterial endotoxin (lipopolysaccharide) to rats has been shown to increase GTPCH I activity and BH4 levels in the cerebellum, liver, spleen, and adrenal gland (Werner-Felmayer et al, 1993).

In the present study, we examined the regulation of GTPCH I activity and BH4 levels in experimental cryptorchid testes and the effect of oral administration of BH4 on these processes and on testicular damage.


   Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animal Preparation

Four-week-old C57BL/6 male mice were purchased from Clea (Tokyo, Japan). All animal experiments were conducted according to the Guidelines for Animal Experiments at Kobe University School of Medicine. The animals were divided into 2 groups and fed ad libitum either of the following diets for 6 weeks: 1) standard chow or 2) standard chow supplemented with 10 mg/kg/d sapropterin hydrochloride (chemically synthesized BH4; donated by Daiichi Suntory Pharma, Tokyo, Japan). To induce right cryptorchidism, each mouse was anesthetized and a small incision was made in the upper abdomen. General anesthesia was given with sodium pentobarbital, 40 mg/kg intraperitoneally, and the abdomen was shaved and prepared with Betadine. The right testis was gently brought up into the abdominal cavity and fixed on the upper abdominal wall. Samples were taken from the testes at 0, 3, 5, 7, and 10 days after surgery (n = 6 at each time point). The weight of each testis was determined before the assays were performed.

BH4 and Dihydrobiopterin Content

Measurements of biopterin content were performed by high-performance liquid chromatography analysis as reported previously (Masada et al, 1985). The amount of BH4 was estimated from the difference between the total (BH4 + dihydrobiopterin [BH2] + oxidized biopterin) and alkaline-stable biopterin (BH2 + oxidized biopterin).

Measurement of Testis NO Concentration

Testicular tissue was homogenized in 10 times its weight of ice-cold buffer containing 20 mM Tris HCl and 2 mM EDTA (pH 7.4). NO production in the testis was quantified indirectly as nitrite (NO2)/nitrate (NO3) from testicular homogenates using a commercial NO colorimetric assay kit (Dojindo Laboratories, Kumamoto, Japan) based on the Griess method. The data from this assay represent the sum of nitrite and nitrate and were expressed in µM.

Western Blot Analysis of NOS Proteins and Nitrotyrosine

Whole-cell proteins were extracted from homogenized tissue using lysis buffer containing 50 mM Tris HCl (pH 7.4), 1 mM EGTA, 1 mM dithiothreitol, 1 µM pepstatin A, 2 µM leupeptin, and 1 µM (p-amidinophenyl) methane sulfonyl fluoride. Protein concentrations were determined by the method of Bradford (Bio-Rad Laboratories, Hercules, Calif) with bovine serum albumin fraction V as the standard protein. Proteins (30 µg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (7.5%; ATTO Corp, Tokyo, Japan) and then transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat dried milk, 0.03% Tween-20 in phosphate-buffered saline (PBS) for 1 hour and then probed with mouse monoclonal anti-eNOS (1:1000), mouse monoclonal anti-iNOS (1:1000), rabbit polyclonal anti-nNOS (1:1000; all from BD Transduction Laboratories, San Jose, Calif), mouse monoclonal anti-nitrotyrosine (1:1000; Santa Cruz Biotechnology, Santa Cruz, Calif), and mouse monoclonal anti-β-actin (1:2000; Sigma-Aldrich, St Louis, Mo) antibodies. Immunoreactive bands were visualized with horseradish peroxidase–conjugated anti-rabbit immunoglobulin G (IgG), anti-mouse IgG, or anti-goat IgG using an electrochemiluminescent detection kit (Amersham International PLC, Buckinghamshire, United Kingdom).

Quantitative analysis was performed with densitometry (Scion Image; Scion Corp, Frederick, Md) using β-actin as an internal control. We estimated the concentration of ONOO using nitrotyrosine levels as an index.

Reverse Transcriptase Polymerase Chain Reaction for GTPCH I

Total RNA was extracted from testicular tissue using TRIzol reagent (Life Technologies Inc, Grand Island, NY) according to the manufacturer's instructions. RNA concentrations were measured using 260/280 UV spectrophotometry. Reverse transcriptase (RT) reactions with total RNA (5 µg) were carried out using the SuperScript III First-Strand Synthesis System made by Invitrogen (Carlsbad, Calif) according to the manufacturer's instructions. A no-template control was established for each experiment to confirm the absence of genomic contamination of the samples. Polymerase chain reaction (PCR) was performed using 1 µL of each RT product as a template. The following primers were used for PCR amplification to detect GTPCH I: forward, TGCTCAAGACGCCCTGGAGG; reverse, AGGACTTGCTTGTTAGGAAG. Takara Ex Taq Hot Start Version (TAKARA BIO Inc, Shiga, Japan) was used at 2.5 units/µL. The PCR mixture (50 µL) contained 2 mM MgCl2, 1X Ex Taq Buffer, and 0.5 µM each primer. Amplification was performed in a programmable thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Foster City, Calif). The samples were first denatured at 94°C for 2 minutes, followed by 38 PCR cycles; the temperature profile was 95°C (30 seconds), 57°C (30 seconds), and 72°C (90 seconds). After the last cycle, an additional extension incubation was performed (72°C for 7 minutes). After amplification, PCR products (10 µL of each sample) were electrophoresed in 2% ultra pure agarose (Invitrogen) gels containing ethidium bromide (1 µg/mL), and the bands were visualized by UV fluorescence. Densitometric analysis was performed using Scion Image after photography with a computer-assisted camera (Kodak, Tokyo, Japan). GTPCH I mRNA levels were normalized with β-actin values and were expressed as arbitrary units relative to the control, set as a value of 1.

Immunohistochemistry

For immunohistochemical detection of eNOS, sections were stained using an avidin biotinylated complex kit (Vector Laboratories, Burlingame, Calif). Harvested testis samples were fixed for 24 hours in 10% formalin neutral buffer solution (WAKO, Osaka, Japan). Paraffin-embedded tissues were sectioned at a thickness of 5 µm and then mounted on silanized slides. The sections were deparaffinized, hydrated, and incubated for 10 minutes in fresh 3% H2O2 in PBS (pH 7.4) to block endogenous peroxidases. Nonspecific staining was blocked using normal blocking horse serum for 40 minutes. After 2 rinses in deionized water, sections were incubated overnight at 4°C with a primary eNOS antibody at a 1:10 000 dilution (BD Transduction Laboratories) and then washed 2 times in PBS. Biotinylated anti-mouse IgG was used as a secondary antibody for 30 minutes. After incubation with an avidin-biotin-peroxidase complex for 30 minutes, peroxidase activity was detected by diaminobenzidine peroxidase. Sections were counterstained with methyl green, dehydrated in butanol, and mounted in buffered glycerin. For negative control slides, the primary antibody solution was replaced with PBS.

Terminal Deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling Method

In situ analysis of DNA fragmentation (terminal deoxynucleotidyl transferase [TdT] biotin-dUTP nick end labeling [TUNEL] method): The ApopTag kit (Serologicals Corp, Norcross, Ga) was used to detect DNA fragmentation following the procedure recommended by the supplier. Sections were deparaffinized, rinsed in distilled water, and allowed to react with proteinase K (20 µg/mL). After a rinse in distilled water, sections were treated with 3% H2O2 to inactivate endogenous peroxidases. DNA nick end labeling included the following steps: 1) reaction with digoxigenin-dNTP in the TdT reaction solution, 2) incubation with antidigoxigenin-peroxidase conjugate, and 3) visualization with 3,3'-diaminobenzidine tetrahydrochloride as a chromogen. The sections were lightly counterstained with methyl green before microscopic evaluation. For the negative control, sections were treated with the same procedure but without TdT. Twenty cross-sections of seminiferous tubules were selected randomly and observed, and the rate of germ cell apoptosis was expressed as the number of apoptotic germ cells per tubule.

Statistical Analysis

Student's t test for unpaired observations was used to determine the significance of differences between mice with BH4 and without BH4. Statistical analysis for multiple comparisons was performed using 1-way analysis of variance with Bonferroni correction. All values are given as means ± SEM, and significance was accepted at P < .05.


   Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Testicular Weights

The weights of scrotal testes were unchanged throughout the study period. In the standard-diet group, the weights of the cryptorchidism testes decreased to 77%, 69%, and 51% of those of the left scrotal testes on days 5, 7, and 10, respectively. However, in the BH4-treated group, weight reduction was attenuated (76%, 74%, and 63% of the contralateral scrotal testes on days 5, 7, and 10, respectively). A significant difference between the 2 groups was only seen on day 10 (P = .01; n = 6–8) (Figure 1).


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Figure 1. Time course of weight changes in cryptorchid and scrotal testes from the tetrahydropterin treatment and nontreatment groups. The time course of cryptorchid testis weight changes are presented as percentages of the contralateral scrotal testis weight. The weights of scrotal testes were unchanged throughout the study period. Data are presented as means ± SEM. * indicates P < .05 (treatment group vs nontreatment group).

 

GTPCH I mRNA and BH4 Levels in Testes

GTPCH I mRNA expression levels in the cryptorchid testes of the standard-diet group were 1.5- to 2-fold (P < .05) higher than those of day 0 mice (Figure 2; n = 3), and the testicular BH4 concentrations were elevated significantly on days 7 and 10 compared with those of day 0 mice (P = .0007 and < .0001, respectively; n = 3; Figure 3). Oral BH4 treatment suppressed the increase in GTPCH I mRNA levels (Figure 2; n = 3) and significantly decreased testicular BH4 concentrations on days 3, 5, 7, and 10 compared with those of day 0 mice (P = .003, .004, .02, and .02, respectively; n = 3; Figure 3). For GTPCH I mRNA levels and BH4 concentrations, these 2 groups showed significant differences at all time points after induction of cryptorchidism (P < .0001). These findings suggested that the experimental induction of cryptorchidism enhanced endogenous BH4 synthesis and that oral administration of BH4 reduced its production.


Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
Figure 2. GTP cyclohydrolase I (GTPCH I) mRNA expression levels in cryptorchid testes were determined by reverse transcriptase polymerase chain reaction. β-actin was used as an internal control. In the nontreatment group, GTPCH I mRNA expression levels significantly increased from day 3. Tetrahydropterin (BH4) treatment suppressed the rise in GTPCH I mRNA expression. Data are presented as means ± SEM. * indicates P < .05 (treatment group vs nontreatment group). (a) P < .05 (vs day 0 mice in the BH4 treatment group). (b) P < .05 (vs day 0 mice in the nontreatment group).

 

Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Figure 3. Tetrahydropterin (BH4) concentrations in cryptorchid testes were assayed by high-performance liquid chromatography and expressed as µmol/g. In the nontreatment group, testicular BH4 concentrations were elevated, but oral BH4 treatment significantly decreased the testicular BH4 concentration. The BH4 treatment group and the nontreatment group showed significant differences at all time points after induction of cryptorchidism. Data are presented as means ± SEM. * indicates P < .05 (treatment group vs nontreatment group). (a) P < .05 (vs day 0 mice in the BH4 treatment group). (b) P < .05 (vs day 0 mice in the nontreatment group).

 
Testes BH2 Concentrations

As shown in Figure 4 (n = 3), BH2 concentrations increased significantly until day 5 in both groups, and this elevation continued in the nontreatment group. Interestingly, in the BH4-treated group, BH2 concentrations decreased from day 7 and were significantly lower than those of the standard-diet group on days 7 and 10 (P = .0004 and < .0001, respectively).


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
Figure 4. Dihydrobiopterin (BH2) concentrations in cryptorchid testes were assayed by high-performance liquid chromatography and expressed as µmol/g. BH2 concentrations increased until day 5 in both groups and continued its rise in the nontreatment group after day 5. In the tetrahydropterin (BH4) treatment group, the BH2 concentration decreased from day 7. Data are presented as means ± SEM. * indicates P < .05 (treatment group vs nontreatment group). (a) P < .05 (vs day 0 mice in the BH4 treatment group). (b) P < .05 (vs day 0 mice in the nontreatment group).

 

Testes NO Concentrations

The NO concentrations of scrotal testes were unchanged throughout the study period (data not shown). After the induction of cryptorchidism, the NO concentrations in testes were elevated from day 5 in both groups (Figure 5; n = 3–5). On day 10, the NO concentrations in cryptorchid testes of the nontreatment group were 2.1-fold higher than those of the BH4-treated group (P = .008).


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
Figure 5. The testicular nitric oxide (NO) concentration was measured using the Griess method as described in "Materials and Methods" and expressed as µmol/g. The NO concentration gradually increased in the tetrahydropterin (BH4) treatment and nontreatment groups, but BH4 treatment suppressed NO production on day 10. Data are presented as means ± SEM. * indicates P < .05 (treatment group vs nontreatment group). (a) P < .05 (vs day 0 mice in the BH4 treatment group). (b) P < .05 (vs day 0 mice in the nontreatment group).

 


Figure 6
View larger version (36K):
[in this window]
[in a new window]

 
Figure 6. Endothelial nitric oxide synthase (eNOS) and ONOO (a determinant of NO-dependent damage) protein expression levels were determined by Western blot analysis. eNOS and ONOO protein expression levels showed the same changes as NO concentration. Significant differences were observed on day 10 between the tetrahydropterin (BH4) treatment and nontreatment groups; ONOO protein expression decreased in the BH4 treatment group. This dissociation of the ONOO protein might be due to superoxide produced by "uncoupled" eNOS because of the increased dihydrobiopterin concentration in the standard-diet group. Data are presented as means ± SEM. * indicates P < .05 (treatment group vs nontreatment group).

 
NOS and Nitrotyrosine Expression

Neither iNOS nor nNOS protein was detected in either scrotal or cryptorchid testes (data not shown). eNOS protein expression in cryptorchid testes in the nontreatment group gradually increased over time; on day 10, the level was 4.3-fold higher than that of day 0 testes (Figure 6; n = 4). In the BH4-treated group, the expression in cryptorchid testes increased similarly to the nontreatment group; however, the expression level was only 2.3-fold higher on day 10 than that of day 0 testes and was significantly lower than that of nontreatment testes on day 10 (P = .02).

The level of nitrotyrosine was increased by induction of cryptorchidism and inhibited by BH4 treatment, becoming significantly different on day 10 compared with that in the standard-diet group (P < .0001; Figure 6).


Figure 7
View larger version (134K):
[in this window]
[in a new window]

 
Figure 7. Histologic sections of mouse testes stained with hematoxylin and eosin. Figures on the left are from the tetrahydropterin (BH4) treatment group on (a) day 3, (c) day 5, (e) day 7, and (g) day 10, and figures on the right are from the nontreatment group on (b) day 3, (d) day 5, (f) day 7, and (h) day 10. Slight alterations were observed in spermatogenesis by day 3, and some pyknotic germ cells along with multinucleated giant cells were detected by day 5 in both groups. Disruption of spermatogenic epithelium continued on day 7 and in the nontreatment group, and many vacuolated seminiferous epithelium cells with a single layer of germ cells close to the basement membrane were observed. On day 10 in the untreated group, most seminiferous tubules were destroyed and the lumens were lost. In the BH4 treatment group, there were some giant cells and pyknotic germ cells, but the form of the seminiferous tubules was maintained.

 
GTPCH I mRNA levels, BH4 and BH2 concentrations, and eNOS and nitrotyrosine expression levels of scrotal testes were unchanged throughout the study period.

Histology and Germ Cell Apoptosis

Histology of the cryptorchid testes following right cryptorchidism on days 3, 5, 7, and 10 is shown in Figure 7. From day 3, the seminiferous epithelium was disrupted and multinucleated giant cells were found in cryptorchid testes of both groups. In the standard-diet group, there was a high prevalence of TUNEL-positive cells in tubules until day 7; the number of TUNEL-positive cells then decreased on day 10 (Figure 8A), with many tubules on day 10 showing empty lumens and epithelia that appeared spongy (Figure 8B). Likewise, in the BH4-treated group, TUNEL-positive cells in tubules increased until day 10, but few tubules showed empty lumens on day 10 and the number of TUNEL-positive cells was significantly lower on day 7 and higher on day 10 than those in the nontreatment group (P < .0001 and < .0001, respectively). TUNEL-positive cells and eNOS activity were colocalized in consecutive tissues (Figure 8C). These results indicated that eNOS could be associated with germ cell apoptosis and BH4 treatment could attenuate testicular damage due to experimental cryptorchidism.


Figure 8
View larger version (76K):
[in this window]
[in a new window]

 
Figure 8. In situ analysis of DNA fragmentation in testicular sections (A and B). (A) Expresses the rate of germ cell apoptosis per tubule. (B) Figures on the left are from the tetrahydropterin (BH4) treatment group on (a) day 3, (c) day 5, (e) day 7, and (g) day 10, and figures on the right are from the nontreatment group on (b) day 3, (d) day 5, (f) day 7, and (h) day 10. The number of terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling (TUNEL)–positive cells increased from day 3 in both groups. In the BH4 treatment group, the number of positive cells was significantly lower than that in the nontreatment group on day 7. The decrease in positive cells by day 10 in the nontreatment group could be the result of advanced destruction of the seminiferous tubules. (C) Seminiferous tubules on day 7 after the induction of cryptorchidism in the nontreatment group. TUNEL-positive cells and endothelial nitric oxide synthase activity were colocalized in consecutive tissues (arrow). Data are presented as means ± SEM. * indicates P < .05 (treatment group vs nontreatment group).

 

   Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The major new findings of the present study are: 1) after induction of experimental cryptorchidism, GTPCH I mRNA and BH4 levels were increased and eNOS protein expression, NO concentrations, and nitrotyrosine levels gradually rose over time; and 2) oral administration of BH4 decreased GTPCH I mRNA and BH4 levels, with concomitant reductions of eNOS protein levels, nitrotyrosine levels, and NO concentrations, resulting in reduced testicular damage. These results suggest that the regulation of BH4 may provide a basis for therapeutic strategies for heat stress–based testicular dysfunction.

All 3 NOS isoforms are expressed in testis and have been reported to play important roles in various states. nNOS was expressed in Leydig cells, and a variant of it was recently identified (Wang et al, 2002). The up-regulation of NO formation might be responsible for decreasing the concentrations of steroidogenic proteins (Welch et al, 1995; Del Punta et al, 1996; Pomerantz and Pitelka, 1998). Otherwise, Lue et al (2003) provided evidence that iNOS through its product, NO, participates in the induction of heat-induced germ cell apoptosis. Shiraishi et al (2001) also provided evidence that iNOS expression was markedly increased 1 hour after ischemia and was accompanied by high NO production, with a peak after 48 hours of reperfusion in an experimental torsion model. Our study showed that iNOS and nNOS proteins were below the detection levels by Western blot analysis. Most studies of testicular NOS expression have been performed using immunohistochemistry, Northern blot analysis, or RT-PCR analysis; we also detected low levels of iNOS within Sertoli and Leydig cells and low levels of nNOS in Leydig cells by immunohistochemistry, but there were no significant changes throughout the study period (data not shown). Therefore, we interpreted the findings as indicating that these proteins may not have important functions in experimental cryptorchidism.


Figure 9
Figure 9
View larger version (26K):
[in this window]
[in a new window]

 
Figure 9. (A) Schematic illustration of the possible mechanism of GTP cyclohydrolase I (GTPCH I) and tetrahydropterin (BH4) regulation of endothelial nitric oxide synthase (eNOS) expression and oxidative stress in experimental cryptorchidism. Experimental cryptorchid testes induced the increases in GTPCH I mRNA expression, BH4 levels, eNOS protein expression, NO concentration, and ONOO levels. (B) Oral administration of BH4 decreased GTPCH I mRNA and BH4 levels, with concomitant reduction of eNOS protein levels, ONOO levels, and NO concentration, resulting in reduced testicular damage1.

 
eNOS has been shown to be expressed in myofibroblasts of the peritubular lamina propria, endothelial and smooth muscle cells of large blood vessels, Sertoli cells, and Leydig cells in the testes (Zini et al, 1996; Middendorff et al, 1997; Fujisawa et al, 2001) and in degenerating germ cells in normal and cryptorchid testes (Zini et al, 1999). In this study, eNOS levels were elevated and up-regulated testicular NO and nitrotyrosine production in cryptorchid testes. These findings suggest that abdominal heat stress induces germ cell loss through NOS-, NO-, and ONOO-dependent pathways responsible for germ cell toxicity as Rosselli et al (1995) proposed previously.

GTPCH I activity and BH4 concentrations increase in diseased states in the cerebellum, liver, spleen, and adrenal gland (Werner-Felmayer et al, 1993). Kidd et al (2005) reported that GTPCH I activity, BH4 levels, iNOS activity, and ONOO levels increase after cerebral ischemic reperfusion. Likewise, in our study, GTPCH I mRNA, BH4, eNOS, and nitrotyrosine levels but not iNOS levels were elevated after induction of cryptorchidism. Other studies have demonstrated that exogenous H2O2 increases BH4 concentrations through the induction of GTPCH I in mouse brain microvascular endothelial cells (Shimizu et al, 2003), and oxidants, including hydroxyl radicals and ONOO, markedly induce BH4 levels via a de novo pathway in vascular endothelial cells (Shimizu et al, 2005). Our results showed that ONOO can stimulate BH4 production through the induction of GTPCH I in experimental cryptorchidism.

In atherosclerotic vessels, tissue levels of BH4 seem to be reduced in the presence of hypercholesterolemia and BH4 can rapidly be oxidized to BH2 by reactive oxygen species (ROS); these conditions are associated with eNOS "uncoupling" and increased ROS (Kuzkaya et al, 2003; Alp and Channon, 2004). Experimental cryptorchidism in adult rats leads to increased peroxidation of cellular lipids as a sign of oxidative stress (Ahotupa and Huhtaniemi, 1992). The levels of lipid peroxidation are significantly increased in either untreated immature rats before normal testicular descent or in experimentally induced cryptorchidism (Peltola et al, 1995). These findings indicate that experimental cryptorchidism leads to oxidative stress and overproduction of superoxide and H2O2. We did not examine the superoxide and H2O2 levels, and this should be addressed in future studies. The reaction between superoxide anions and NO produces ONOO, which is a strong biologic oxidant leading to the oxidization of lipids, proteins, sulfhydryls, and DNA (Salgo and Pryor, 1996; Grace et al, 1998; Zhao et al, 2001). Drummond et al (2000) reported that H2O2 induces eNOS expression through transcriptional and posttranscriptional mechanisms. It is known that BH4 is probably a crucial target for ONOO (Kuzkaya et al, 2003), and our results suggest that endogenous BH4 synthesis is enhanced and the oxidization of BH4 to BH2 can be accelerated in experimental cryptorchidism. These processes lead to more eNOS uncoupling and increase the production of superoxide anions. These findings suggest that experimental cryptorchidism may cause the vicious cycle of overproduction of eNOS, NO, H2O2, and superoxide. It is considered that the up-regulation of eNOS after exposure to H2O2 is a compensatory response to the inactivation of NO and that the up-regulation stimulates NO production (Drummond et al, 2000). However, these responses result in more ONOO formation and more extensive damage. Our findings suggest that these responses also occur in surgically induced cryptorchidism. Although the protective effect of exogenous BH4 may be simply due to its potent direct antioxidant action, Channon (2004) reported that the pharmacologic approach of BH4 supplementation, either by administration of BH4 or sepiapterin, is potentially confounded by the administration of very high, supraphysiologic concentrations that may exert nonspecific effects on NO bioavailability through scavenging of superoxide and other ROS. In the case of supplementation with high doses of sepiapterin, which is converted to BH4 in cells through the pterin salvage pathway, nonspecific effects may be marked and unpredictable (Vasquez-Vivar et al, 2002). However, some investigators have attempted to control for nonspecific effects. For example, administration of BH4 improved forearm blood flow in smokers, whereas the chemically similar tetrahydroneopterin, which has antioxidant properties but cannot act as a NOS cofactor, had no effect (Heitzer et al, 2000). In this study, we used 10 mg/kg/d BH4 as the experimental concentration. We consider this a pharmacologic concentration that does not produce any substantial antioxidant protection from superoxide or peroxynitrite.

BH4 was chosen for our study because of the present clinical use of BH4 supplementation to ameliorate some forms of phenylketonuria. In addition, a recent study demonstrated that superoxide is produced in vivo from dysfunctional "uncoupled" eNOS under hypercholesterolemia, atherosclerosis, hypertension, and cigarette smoking conditions, inducing endothelial dysfunction, which was improved by acute administration of BH4 (Tiefenbacher et al, 2000; Setoguchi et al, 2001). These studies reported that oral administration of BH4 significantly increased the BH4 concentrations in cardiovascular tissues, and other studies (Miller et al, 1986; Anastasiadis et al, 1994; Ishida et al, 1998) have reported that BH4 administration increased the concentration of BH4 in the brain. In our study, testicular BH4 concentrations were unchanged with or without BH4 treatment at day 0, and we consider that this may be due to negative feedback inhibitory effects on GTPCH I activity via the GTPCH I feedback protein (Harada et al, 1993; Milstien et al, 1996), and further experiments are necessary to delineate the underlying mechanism.

First we anticipated that BH4 concentrations would be elevated after oral administration of BH4, but these concentrations in the BH4 treatment group decreased after day 3. Although there is, to our knowledge, no literature that describes such decreases in GTPCH I mRNA levels and BH4 concentrations in other tissues, considering that these changes were induced by testes impairment as well as by oral administration of BH4, it is thought that 1) GTPCH I mRNA is regulated by exogenous BH4 in experimental cryptorchidism and 2) BH4 supplementation improves eNOS coupling, resulting in much lower superoxide production and increases in the bioavailability of NO, which may lead to down-regulation of eNOS expression (Drummond et al, 2000). These actions of BH4 may stop the vicious cycle of overproduction of eNOS, NO, H2O2, superoxide, and ONOO (proposed model; Figure 9). In conclusion, experimental cryptorchidism leads to endogenous BH4 production via GTPCH I and the induction of eNOS expression. Although it is possible that these reactions during oxidative stress are a self-protective mechanism, these responses may cause more oxidative stress and more extensive damage. Oral administration of BH4 can decrease the damage by interrupting the vicious cycle of oxidative stress in experimental cryptorchidism. BH4 could provide a new therapeutic intervention in heat stress–based testicular dysfunction.


   References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Ahotupa M, Huhtaniemi I. Impaired detoxification of reactive oxygen and consequent oxidative stress in experimentally cryptorchid rat testis. Biol Reprod. 1992; 46: 1114 –1118.[Abstract]

Alp NJ, Channon KM. Regulation of endothelial nitric oxide synthase by tetrahydrobiopterin in vascular disease. Arterioscler Thromb Vasc Biol. 2004;24: 413 –420.[Abstract/Free Full Text]

Anastasiadis PZ, Kuhn DM, Levine RA. Tetrahydrobiopterin uptake into rat brain synaptosomes, cultured PC12 cells, and rat striatum. Brain Res. 1994; 665: 77 –84.[CrossRef][Medline]

Channon KM. Tetrahydrobiopterin: regulator of endothelial nitric oxide synthase in vascular disease. Trends Cardiovasc Med. 2004;14: 323 –327.[CrossRef][Medline]

Del Punta K, Charreu EH, Pignataro OP. Nitric oxide inhibits Leydig cell steroidogenesis. Endocrinology. 1996; 137: 5337 –5343.[Abstract]

Drummond GR, Cai H, Davis ME, Ramasamy S, Harrison DG. Transcriptional and posttranscriptional regulation of endothelial nitric oxide synthase expression by hydrogen peroxide. Circ Res. 2000; 86: 347 –354.[Abstract/Free Full Text]

Fujisawa M, Yamanaka K, Tanaka H, Tanaka H, Okada H, Arakawa S, Kamidono S. Expression of endothelial nitric oxide synthase in the Sertoli cells of men with infertility of various causes. BJU Int. 2001;87: 85 –88.[CrossRef][Medline]

Grace SC, Salgo MG, Pryor WA. Scavenging of peroxynitrite by a phenolic/peroxidase system prevents oxidative damage to DNA. FEBS Lett. 1998;426: 24 –28.[CrossRef][Medline]

Harada T, Kagamiyama H, Hatakeyama K. Feedback regulation mechanisms for the control of GTP cyclohydrolase I activity. Science. 1993;260: 1507 –1510.[Abstract/Free Full Text]

Heitzer T, Brockhoff C, Mayer B, Warnholtz A, Mollnau H, Henne S, Meinertz T, Munzel T. Tetrahydrobiopterin improves endothelium-dependent vasodilation in chronic smokers: evidence for a dysfunctional nitric oxide synthase. Circ Res. 2000; 86: E36 –E41.[Medline]

Ishida Y, Todaka K, Kuwahara I, Hashiguchi H, Ishizuka Y, Nakane H, Mitsuyama Y. Peripherally administered tetrahydrobiopterin increases in vivo tryptophan hydroxylase activity in the striatum after transplantation of fetal ventral mesencephalon in six hydroxydopamine lesioned rats. Neurosci Lett. 1998; 253: 45 –48.[CrossRef][Medline]

Ishikawa T, Kondo Y, Goda K, Fujisawa M. Overexpression of endothelial nitric oxide synthase in transgenic mice accelerates testicular germ cell apoptosis induced by experimental cryptorchidism. J Androl. 2005;26: 281 –288.[Abstract/Free Full Text]

Kidd GA, Hong H, Majid A, Kaufman DI, Chen AF. Inhibition of brain GTP cyclohydrolase I and tetrahydrobiopterin attenuates cerebral infarction via reducing inducible NO synthase and peroxynitrite in ischemic stroke. Stroke. 2005;36: 2705 –2711.[Abstract/Free Full Text]

Kuzkaya N, Weissmann N, Harrison DG, Dikalov S. Interactions of peroxynitrite, tetrahydrobiopterin, ascorbic acid, and thiols: implications for uncoupling endothelial nitric-oxide synthase. J Biol Chem. 2003;278: 22546 –22554.[Abstract/Free Full Text]

Lue Y, Sinha Hikim AP, Wang C, Leung A, Swerdloff RS. Functional role of inducible nitric oxide synthase in the induction of male germ cell apoptosis, regulation of sperm number, and determination of testes size: evidence from null mutant mice. Endocrinology. 2003; 144: 3092 –3100.[Abstract/Free Full Text]

Masada M, Akino M, Sueoka T, Katoh S. Dyspropterin, an intermediate formed from dihydroneopterin triphosphate in the biosynthetic pathway of tetrahydrobiopterin. Biochem Biophys Acta. 1985; 840: 235 –244.[Medline]

Middendorff R, Müller D, Wichers S, Holstein AF. Evidence for production and functional activity of nitric oxide in seminiferous tubules and blood vessels of the human testis. J Clin Endocrinol Metab. 1997;82: 4154 –4161.[Abstract/Free Full Text]

Miller L, Insel T, Scheinin M, Aloi J, Murphy DL, Linnoila M, Lovenberg W. Tetrahydrobiopterin administration to rhesus macaques. Its appearance in CSF and effect on neurotransmitter synthesis. Neurochem Res. 1986; 11: 291 –298.[CrossRef][Medline]

Milstien S, Jaffe H, Kowlessur D, Bonner TI. Purification and cloning of the GTP cyclohydrolase I feedback regulatory protein, GFRP. J Biol Chem. 1996; 271: 19743 –19751.[Abstract/Free Full Text]

Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J. 1992;6: 3051 –3064.[Abstract]

Peltola V, Huhtaniemi I, Ahotupa M. Abdominal position of the rat testis is associated with high levels of lipid peroxidation. Biol Reprod. 1995;53: 1146 –1150.[Abstract]

Pomerantz DK, Pitelka V. Nitric oxide is a mediator of the inhibitory effect of activated macrophages on production of androgen by the Leydig cell of the mouse. Endocrinology. 1998; 139: 922 –931.[Abstract/Free Full Text]

Rosenkranz-Weiss P, Sessa WC, Milstien S, Kaufman S, Watson CA, Pober JS. Regulation of nitric oxide synthesis by proinflammatory cytokines in human umbilical vein endothelial cells. Elevations in tetrahydrobiopterin levels enhance endothelial nitric oxide synthase specific activity. J Clin Invest. 1994; 93: 2236 –2243.[Medline]

Rosselli M, Dubey RK, Imthurn B, Macas E, Keller PJ. Effects of nitric oxide on human spermatozoa: evidence that nitric oxide decreases sperm motility and induces sperm toxicity. Hum Reprod. 1995; 10: 1786 –1790.[Abstract/Free Full Text]

Salgo MG, Pryor WA. Trolox inhibits peroxynitrite-mediated oxidative stress and apoptosis in rat thymocytes. Arch Biochem Biophys. 1996;333: 482 –488.[CrossRef][Medline]

Schott K, Gutlich M, Ziegler I. Induction of GTP-cyclohydrolase I mRNA expression by lectin activation and interferon-{gamma} treatment in human cells associated with the immune response. J Cell Physiol. 1993;156: 12 –16.[CrossRef][Medline]

Scott-Burden T, Elizondo E, Ge T, Boulanger CM, Vanhoutte PM. Growth factor regulation of interleukin-1 β-induced nitric oxide synthase and GTP cyclohydrolase expression in cultured smooth muscle cells. Biochem Biophys Res Commun. 1993; 196: 1261 –1266.[CrossRef][Medline]

Setoguchi S, Mohri M, Shimokawa H, Takeshita A. Tetrahydrobiopterin improves endothelial dysfunction in coronary microcirculation in patients without epicardial coronary artery disease. J Am Coll Cardiol. 2001;38: 493 –498.[Abstract/Free Full Text]

Shimizu S, Ishii M, Miasaka Y, Wajima T, Negoro T, Hagiwara T, Kiuchi Y. Possible involvement of hydroxyl radical on the stimulation of tetrahydrobiopterin synthesis by hydrogen peroxide and peroxynitrite in vascular endothelial cells. Int J Biochem Cell Biol. 2005; 37: 864 –875.[CrossRef][Medline]

Shimizu S, Shiota K, Yamamoto S, Miyasaka Y, Ishii M, Watabe T, Nishida M, Mori Y, Yamamoto T, Kiuchi Y. Hydrogen peroxide stimulates tetrahydrobiopterin synthesis through the induction of GTP-cyclohydrolase I and increases nitric oxide synthase activity in vascular endothelial cells. Free Radic Biol Med. 2003; 34: 1343 –1352.[CrossRef][Medline]

Shiraishi K, Naito K, Yoshida K. Nitric oxide promotes germ cell necrosis in the delayed phase after experimental testicular torsion of rat. Biol Reprod. 2001; 65: 514 –521.[Abstract/Free Full Text]

Tiefenbacher CP, Bleeke T, Vahl C, Amann K, Vogt A, Kubler W. Endothelial dysfunction of coronary resistance arteries is improved by tetrahydrobiopterin in atherosclerosis. Circulation. 2000; 102: 2172 –2179.[Abstract/Free Full Text]

Vasquez-Vivar J, Duquaine D, Whitsett J, Kalyanaraman B, Rajagopalan S. Altered tetrahydrobiopterin metabolism in atherosclerosis: implications for use of oxidized tetrahydrobiopterin analogues and thiol antioxidants. Arterioscler Thromb Vasc Biol. 2002; 22: 1655 –1661.[Abstract/Free Full Text]

Wang Y, Newton DC, Miller TL, Teichert AM, Phillips MJ, Davidoff MS, Marsden PA. An alternative promoter of the human neuronal nitric oxide synthase gene is expressed specifically in Leydig cells. Am J Pathol. 2002;160: 369 –380.[Medline]

Welch C, Watson ME, Poth M, Hong T. Francis GL. Evidence to suggest nitric oxide is an interstitial regulator of Leydig cell steroidogenesis. Metabolism. 1995; 44: 234 –238.[CrossRef][Medline]

Werner ER, Werner-Felmayer G, Fuchs D, Hausen A, Reibnegger G, Yim JJ, Pfleiderer W, Wachter H. Tetrahydrobiopterin biosynthetic activities in human macrophages, fibroblasts, THP-1, and T 24 cells. GTP-cyclohydrolase I is stimulated by interferon-{gamma}, and 6-pyruvoyl tetrahydropterin synthase and sepiapterin reductase are constitutively present. J Biol Chem. 1990;265: 3189 –3192.[Abstract/Free Full Text]

Werner-Felmayer G, Prast H, Werner ER, Philippu A, Wachter H. Induction of GTP cyclohydrolase I by bacterial lipopolysaccharide in the rat. FEBS Lett. 1993; 322: 223 –226.[CrossRef][Medline]

Zhao K, Whiteman M, Spencer JP, Halliwell B. DNA damage by nitrite and peroxynitrite: protection by dietary phenols. Methods Enzymol. 2001;335: 296 –307.[Medline]

Zini A, Abitbol J, Schulsinger D, Goldstein M, Schlegel PN. Restoration of spermatogenesis after scrotal replacement of experimentally cryptorchid rat testis: assessment of germ cell apoptosis and eNOS expression. Urology. 1999;53: 223 –227.[CrossRef][Medline]

Zini A, O'Bryan MK, Magid MS, Schlegel PN. Immunohistochemical localization of endothelial nitric oxide synthase in human testis, epididymis, and vas deferens suggest a possible role for nitric oxide in spermatogenesis, sperm maturation, and programmed cell death. Biol Reprod. 1996;55: 935 –941.[Abstract]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
29/2/153    most recent
Author Manuscript (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kondo, Y.
Right arrow Articles by Fujisawa, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kondo, Y.
Right arrow Articles by Fujisawa, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS