| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

From the * Division of Urology, Department of
Organ Therapeutics, Faculty of Medicine, University Graduate School of
Medicine, Kobe, Japan; and the
Department of
Medical Engineering and Systems Cardiology, Kawasaki Medical School,
Kurashiki, Japan.
| Correspondence to: Dr Yutaka Kondo, 7-5-2 Kusunoki-cho, Chuo-ku, Kobe, Hyogo, 650-0017, Japan (e-mail: ykondo{at}med.kobe-u.ac.jp). |
| Received for publication February 25, 2007; accepted for publication September 4, 2007. |
| Abstract |
|---|
|
|
|---|
Key words: Tetrahydrobiopterin, cryptorchidism
Tetrahydrobiopterin (BH4), an essential cofactor of NOS, plays an important
role in the generation of NO (Nathan,
1992). GTP cyclohydrolase I (GTPCH I) is the first-step and
rate-limiting enzyme for BH4 biosynthesis in its de novo pathway
(Alp and Channon, 2004). It was
reported that activation of the immune system results in the production of
interferon-
, which then stimulates an increase in GTPCH I activity in
macrophages, resulting in increases in intracellular BH4 levels and
BH4-dependent NO synthesis in rodents
(Werner et al, 1990).
GTPCH I mRNA and BH4 syntheses are also induced by interferon-
in lymphocytes (Schott et al,
1993); by interleukin-1β in smooth muscle cells
(Scott-Burden et al, 1993);
and by cytokines in endothelial cells, where it regulates the activity of eNOS
(Rosenkranz-Weiss et al,
1994). Administration of bacterial endotoxin (lipopolysaccharide)
to rats has been shown to increase GTPCH I activity and BH4 levels in the
cerebellum, liver, spleen, and adrenal gland
(Werner-Felmayer et al,
1993).
In the present study, we examined the regulation of GTPCH I activity and BH4 levels in experimental cryptorchid testes and the effect of oral administration of BH4 on these processes and on testicular damage.
| Materials and Methods |
|---|
|
|
|---|
BH4 and Dihydrobiopterin Content![]()
Measurements of biopterin content were performed by high-performance liquid
chromatography analysis as reported previously
(Masada et al, 1985). The
amount of BH4 was estimated from the difference between the total (BH4 +
dihydrobiopterin [BH2] + oxidized biopterin) and alkaline-stable biopterin
(BH2 + oxidized biopterin).
Measurement of Testis NO Concentration![]()
Testicular tissue was homogenized in 10 times its weight of ice-cold buffer
containing 20 mM Tris HCl and 2 mM EDTA (pH 7.4). NO production in the testis
was quantified indirectly as nitrite
(NO2–)/nitrate (NO3–)
from testicular homogenates using a commercial NO colorimetric assay kit
(Dojindo Laboratories, Kumamoto, Japan) based on the Griess method. The data
from this assay represent the sum of nitrite and nitrate and were expressed in
µM.
Western Blot Analysis of NOS Proteins and Nitrotyrosine![]()
Whole-cell proteins were extracted from homogenized tissue using lysis
buffer containing 50 mM Tris HCl (pH 7.4), 1 mM EGTA, 1 mM dithiothreitol, 1
µM pepstatin A, 2 µM leupeptin, and 1 µM (p-amidinophenyl) methane
sulfonyl fluoride. Protein concentrations were determined by the method of
Bradford (Bio-Rad Laboratories, Hercules, Calif) with bovine serum albumin
fraction V as the standard protein. Proteins (30 µg) were separated by
sodium dodecyl sulfate polyacrylamide gel electrophoresis (7.5%; ATTO Corp,
Tokyo, Japan) and then transferred to polyvinylidene difluoride membranes. The
membranes were blocked with 5% nonfat dried milk, 0.03% Tween-20 in
phosphate-buffered saline (PBS) for 1 hour and then probed with mouse
monoclonal anti-eNOS (1:1000), mouse monoclonal anti-iNOS (1:1000), rabbit
polyclonal anti-nNOS (1:1000; all from BD Transduction Laboratories, San Jose,
Calif), mouse monoclonal anti-nitrotyrosine (1:1000; Santa Cruz Biotechnology,
Santa Cruz, Calif), and mouse monoclonal anti-β-actin (1:2000;
Sigma-Aldrich, St Louis, Mo) antibodies. Immunoreactive bands were visualized
with horseradish peroxidase–conjugated anti-rabbit immunoglobulin G
(IgG), anti-mouse IgG, or anti-goat IgG using an electrochemiluminescent
detection kit (Amersham International PLC, Buckinghamshire, United
Kingdom).
Quantitative analysis was performed with densitometry (Scion Image; Scion Corp, Frederick, Md) using β-actin as an internal control. We estimated the concentration of ONOO– using nitrotyrosine levels as an index.
Reverse Transcriptase Polymerase Chain Reaction for GTPCH I![]()
Total RNA was extracted from testicular tissue using TRIzol reagent (Life
Technologies Inc, Grand Island, NY) according to the manufacturer's
instructions. RNA concentrations were measured using 260/280 UV
spectrophotometry. Reverse transcriptase (RT) reactions with total RNA (5
µg) were carried out using the SuperScript III First-Strand Synthesis
System made by Invitrogen (Carlsbad, Calif) according to the manufacturer's
instructions. A no-template control was established for each experiment to
confirm the absence of genomic contamination of the samples. Polymerase chain
reaction (PCR) was performed using 1 µL of each RT product as a template.
The following primers were used for PCR amplification to detect GTPCH
I: forward, TGCTCAAGACGCCCTGGAGG; reverse, AGGACTTGCTTGTTAGGAAG. Takara
Ex Taq Hot Start Version (TAKARA BIO Inc, Shiga, Japan) was used at 2.5
units/µL. The PCR mixture (50 µL) contained 2 mM MgCl2, 1X Ex
Taq Buffer, and 0.5 µM each primer. Amplification was performed in a
programmable thermal cycler (GeneAmp PCR System 9700; Applied Biosystems,
Foster City, Calif). The samples were first denatured at 94°C for 2
minutes, followed by 38 PCR cycles; the temperature profile was 95°C (30
seconds), 57°C (30 seconds), and 72°C (90 seconds). After the last
cycle, an additional extension incubation was performed (72°C for 7
minutes). After amplification, PCR products (10 µL of each sample) were
electrophoresed in 2% ultra pure agarose (Invitrogen) gels containing ethidium
bromide (1 µg/mL), and the bands were visualized by UV fluorescence.
Densitometric analysis was performed using Scion Image after photography with
a computer-assisted camera (Kodak, Tokyo, Japan). GTPCH I mRNA levels
were normalized with β-actin values and were expressed as arbitrary units
relative to the control, set as a value of 1.
Immunohistochemistry![]()
For immunohistochemical detection of eNOS, sections were stained using an
avidin biotinylated complex kit (Vector Laboratories, Burlingame, Calif).
Harvested testis samples were fixed for 24 hours in 10% formalin neutral
buffer solution (WAKO, Osaka, Japan). Paraffin-embedded tissues were sectioned
at a thickness of 5 µm and then mounted on silanized slides. The sections
were deparaffinized, hydrated, and incubated for 10 minutes in fresh 3%
H2O2 in PBS (pH 7.4) to block endogenous peroxidases.
Nonspecific staining was blocked using normal blocking horse serum for 40
minutes. After 2 rinses in deionized water, sections were incubated overnight
at 4°C with a primary eNOS antibody at a 1:10 000 dilution (BD
Transduction Laboratories) and then washed 2 times in PBS. Biotinylated
anti-mouse IgG was used as a secondary antibody for 30 minutes. After
incubation with an avidin-biotin-peroxidase complex for 30 minutes, peroxidase
activity was detected by diaminobenzidine peroxidase. Sections were
counterstained with methyl green, dehydrated in butanol, and mounted in
buffered glycerin. For negative control slides, the primary antibody solution
was replaced with PBS.
Terminal Deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling Method![]()
In situ analysis of DNA fragmentation (terminal deoxynucleotidyl
transferase [TdT] biotin-dUTP nick end labeling [TUNEL] method): The ApopTag
kit (Serologicals Corp, Norcross, Ga) was used to detect DNA fragmentation
following the procedure recommended by the supplier. Sections were
deparaffinized, rinsed in distilled water, and allowed to react with
proteinase K (20 µg/mL). After a rinse in distilled water, sections were
treated with 3% H2O2 to inactivate endogenous
peroxidases. DNA nick end labeling included the following steps: 1) reaction
with digoxigenin-dNTP in the TdT reaction solution, 2) incubation with
antidigoxigenin-peroxidase conjugate, and 3) visualization with
3,3'-diaminobenzidine tetrahydrochloride as a chromogen. The sections
were lightly counterstained with methyl green before microscopic evaluation.
For the negative control, sections were treated with the same procedure but
without TdT. Twenty cross-sections of seminiferous tubules were selected
randomly and observed, and the rate of germ cell apoptosis was expressed as
the number of apoptotic germ cells per tubule.
Statistical Analysis![]()
Student's t test for unpaired observations was used to determine
the significance of differences between mice with BH4 and without BH4.
Statistical analysis for multiple comparisons was performed using 1-way
analysis of variance with Bonferroni correction. All values are given as means
± SEM, and significance was accepted at P < .05.
| Results |
|---|
|
|
|---|
|
GTPCH I mRNA and BH4 Levels in Testes![]()
GTPCH I mRNA expression levels in the cryptorchid testes of the
standard-diet group were 1.5- to 2-fold (P < .05) higher than
those of day 0 mice (Figure 2;
n = 3), and the testicular BH4 concentrations were elevated significantly on
days 7 and 10 compared with those of day 0 mice (P = .0007 and <
.0001, respectively; n = 3; Figure
3). Oral BH4 treatment suppressed the increase in GTPCH I
mRNA levels (Figure 2; n = 3)
and significantly decreased testicular BH4 concentrations on days 3, 5, 7, and
10 compared with those of day 0 mice (P = .003, .004, .02, and .02,
respectively; n = 3; Figure 3).
For GTPCH I mRNA levels and BH4 concentrations, these 2 groups showed
significant differences at all time points after induction of cryptorchidism
(P < .0001). These findings suggested that the experimental
induction of cryptorchidism enhanced endogenous BH4 synthesis and that oral
administration of BH4 reduced its production.
|
|
|
Testes NO Concentrations![]()
The NO concentrations of scrotal testes were unchanged throughout the study
period (data not shown). After the induction of cryptorchidism, the NO
concentrations in testes were elevated from day 5 in both groups
(Figure 5; n = 3–5). On
day 10, the NO concentrations in cryptorchid testes of the nontreatment group
were 2.1-fold higher than those of the BH4-treated group (P =
.008).
|
|
The level of nitrotyrosine was increased by induction of cryptorchidism and inhibited by BH4 treatment, becoming significantly different on day 10 compared with that in the standard-diet group (P < .0001; Figure 6).
|
Histology and Germ Cell Apoptosis![]()
Histology of the cryptorchid testes following right cryptorchidism on days
3, 5, 7, and 10 is shown in Figure
7. From day 3, the seminiferous epithelium was disrupted and
multinucleated giant cells were found in cryptorchid testes of both groups. In
the standard-diet group, there was a high prevalence of TUNEL-positive cells
in tubules until day 7; the number of TUNEL-positive cells then decreased on
day 10 (Figure 8A), with many
tubules on day 10 showing empty lumens and epithelia that appeared spongy
(Figure 8B). Likewise, in the
BH4-treated group, TUNEL-positive cells in tubules increased until day 10, but
few tubules showed empty lumens on day 10 and the number of TUNEL-positive
cells was significantly lower on day 7 and higher on day 10 than those in the
nontreatment group (P < .0001 and < .0001, respectively).
TUNEL-positive cells and eNOS activity were colocalized in consecutive tissues
(Figure 8C). These results
indicated that eNOS could be associated with germ cell apoptosis and BH4
treatment could attenuate testicular damage due to experimental
cryptorchidism.
|
| Discussion |
|---|
|
|
|---|
All 3 NOS isoforms are expressed in testis and have been reported to play important roles in various states. nNOS was expressed in Leydig cells, and a variant of it was recently identified (Wang et al, 2002). The up-regulation of NO formation might be responsible for decreasing the concentrations of steroidogenic proteins (Welch et al, 1995; Del Punta et al, 1996; Pomerantz and Pitelka, 1998). Otherwise, Lue et al (2003) provided evidence that iNOS through its product, NO, participates in the induction of heat-induced germ cell apoptosis. Shiraishi et al (2001) also provided evidence that iNOS expression was markedly increased 1 hour after ischemia and was accompanied by high NO production, with a peak after 48 hours of reperfusion in an experimental torsion model. Our study showed that iNOS and nNOS proteins were below the detection levels by Western blot analysis. Most studies of testicular NOS expression have been performed using immunohistochemistry, Northern blot analysis, or RT-PCR analysis; we also detected low levels of iNOS within Sertoli and Leydig cells and low levels of nNOS in Leydig cells by immunohistochemistry, but there were no significant changes throughout the study period (data not shown). Therefore, we interpreted the findings as indicating that these proteins may not have important functions in experimental cryptorchidism.
|
GTPCH I activity and BH4 concentrations increase in diseased states in the cerebellum, liver, spleen, and adrenal gland (Werner-Felmayer et al, 1993). Kidd et al (2005) reported that GTPCH I activity, BH4 levels, iNOS activity, and ONOO– levels increase after cerebral ischemic reperfusion. Likewise, in our study, GTPCH I mRNA, BH4, eNOS, and nitrotyrosine levels but not iNOS levels were elevated after induction of cryptorchidism. Other studies have demonstrated that exogenous H2O2 increases BH4 concentrations through the induction of GTPCH I in mouse brain microvascular endothelial cells (Shimizu et al, 2003), and oxidants, including hydroxyl radicals and ONOO–, markedly induce BH4 levels via a de novo pathway in vascular endothelial cells (Shimizu et al, 2005). Our results showed that ONOO– can stimulate BH4 production through the induction of GTPCH I in experimental cryptorchidism.
In atherosclerotic vessels, tissue levels of BH4 seem to be reduced in the presence of hypercholesterolemia and BH4 can rapidly be oxidized to BH2 by reactive oxygen species (ROS); these conditions are associated with eNOS "uncoupling" and increased ROS (Kuzkaya et al, 2003; Alp and Channon, 2004). Experimental cryptorchidism in adult rats leads to increased peroxidation of cellular lipids as a sign of oxidative stress (Ahotupa and Huhtaniemi, 1992). The levels of lipid peroxidation are significantly increased in either untreated immature rats before normal testicular descent or in experimentally induced cryptorchidism (Peltola et al, 1995). These findings indicate that experimental cryptorchidism leads to oxidative stress and overproduction of superoxide and H2O2. We did not examine the superoxide and H2O2 levels, and this should be addressed in future studies. The reaction between superoxide anions and NO produces ONOO–, which is a strong biologic oxidant leading to the oxidization of lipids, proteins, sulfhydryls, and DNA (Salgo and Pryor, 1996; Grace et al, 1998; Zhao et al, 2001). Drummond et al (2000) reported that H2O2 induces eNOS expression through transcriptional and posttranscriptional mechanisms. It is known that BH4 is probably a crucial target for ONOO– (Kuzkaya et al, 2003), and our results suggest that endogenous BH4 synthesis is enhanced and the oxidization of BH4 to BH2 can be accelerated in experimental cryptorchidism. These processes lead to more eNOS uncoupling and increase the production of superoxide anions. These findings suggest that experimental cryptorchidism may cause the vicious cycle of overproduction of eNOS, NO, H2O2, and superoxide. It is considered that the up-regulation of eNOS after exposure to H2O2 is a compensatory response to the inactivation of NO and that the up-regulation stimulates NO production (Drummond et al, 2000). However, these responses result in more ONOO– formation and more extensive damage. Our findings suggest that these responses also occur in surgically induced cryptorchidism. Although the protective effect of exogenous BH4 may be simply due to its potent direct antioxidant action, Channon (2004) reported that the pharmacologic approach of BH4 supplementation, either by administration of BH4 or sepiapterin, is potentially confounded by the administration of very high, supraphysiologic concentrations that may exert nonspecific effects on NO bioavailability through scavenging of superoxide and other ROS. In the case of supplementation with high doses of sepiapterin, which is converted to BH4 in cells through the pterin salvage pathway, nonspecific effects may be marked and unpredictable (Vasquez-Vivar et al, 2002). However, some investigators have attempted to control for nonspecific effects. For example, administration of BH4 improved forearm blood flow in smokers, whereas the chemically similar tetrahydroneopterin, which has antioxidant properties but cannot act as a NOS cofactor, had no effect (Heitzer et al, 2000). In this study, we used 10 mg/kg/d BH4 as the experimental concentration. We consider this a pharmacologic concentration that does not produce any substantial antioxidant protection from superoxide or peroxynitrite.
BH4 was chosen for our study because of the present clinical use of BH4 supplementation to ameliorate some forms of phenylketonuria. In addition, a recent study demonstrated that superoxide is produced in vivo from dysfunctional "uncoupled" eNOS under hypercholesterolemia, atherosclerosis, hypertension, and cigarette smoking conditions, inducing endothelial dysfunction, which was improved by acute administration of BH4 (Tiefenbacher et al, 2000; Setoguchi et al, 2001). These studies reported that oral administration of BH4 significantly increased the BH4 concentrations in cardiovascular tissues, and other studies (Miller et al, 1986; Anastasiadis et al, 1994; Ishida et al, 1998) have reported that BH4 administration increased the concentration of BH4 in the brain. In our study, testicular BH4 concentrations were unchanged with or without BH4 treatment at day 0, and we consider that this may be due to negative feedback inhibitory effects on GTPCH I activity via the GTPCH I feedback protein (Harada et al, 1993; Milstien et al, 1996), and further experiments are necessary to delineate the underlying mechanism.
First we anticipated that BH4 concentrations would be elevated after oral administration of BH4, but these concentrations in the BH4 treatment group decreased after day 3. Although there is, to our knowledge, no literature that describes such decreases in GTPCH I mRNA levels and BH4 concentrations in other tissues, considering that these changes were induced by testes impairment as well as by oral administration of BH4, it is thought that 1) GTPCH I mRNA is regulated by exogenous BH4 in experimental cryptorchidism and 2) BH4 supplementation improves eNOS coupling, resulting in much lower superoxide production and increases in the bioavailability of NO, which may lead to down-regulation of eNOS expression (Drummond et al, 2000). These actions of BH4 may stop the vicious cycle of overproduction of eNOS, NO, H2O2, superoxide, and ONOO– (proposed model; Figure 9). In conclusion, experimental cryptorchidism leads to endogenous BH4 production via GTPCH I and the induction of eNOS expression. Although it is possible that these reactions during oxidative stress are a self-protective mechanism, these responses may cause more oxidative stress and more extensive damage. Oral administration of BH4 can decrease the damage by interrupting the vicious cycle of oxidative stress in experimental cryptorchidism. BH4 could provide a new therapeutic intervention in heat stress–based testicular dysfunction.
| References |
|---|
|
|
|---|
Alp NJ, Channon KM. Regulation of endothelial nitric oxide synthase
by tetrahydrobiopterin in vascular disease. Arterioscler Thromb
Vasc Biol. 2004;24: 413
–420.
Anastasiadis PZ, Kuhn DM, Levine RA. Tetrahydrobiopterin uptake into rat brain synaptosomes, cultured PC12 cells, and rat striatum. Brain Res. 1994; 665: 77 –84.[CrossRef][Medline]
Channon KM. Tetrahydrobiopterin: regulator of endothelial nitric oxide synthase in vascular disease. Trends Cardiovasc Med. 2004;14: 323 –327.[CrossRef][Medline]
Del Punta K, Charreu EH, Pignataro OP. Nitric oxide inhibits Leydig cell steroidogenesis. Endocrinology. 1996; 137: 5337 –5343.[Abstract]
Drummond GR, Cai H, Davis ME, Ramasamy S, Harrison DG.
Transcriptional and posttranscriptional regulation of endothelial nitric oxide
synthase expression by hydrogen peroxide. Circ Res. 2000; 86: 347
–354.
Fujisawa M, Yamanaka K, Tanaka H, Tanaka H, Okada H, Arakawa S, Kamidono S. Expression of endothelial nitric oxide synthase in the Sertoli cells of men with infertility of various causes. BJU Int. 2001;87: 85 –88.[CrossRef][Medline]
Grace SC, Salgo MG, Pryor WA. Scavenging of peroxynitrite by a phenolic/peroxidase system prevents oxidative damage to DNA. FEBS Lett. 1998;426: 24 –28.[CrossRef][Medline]
Harada T, Kagamiyama H, Hatakeyama K. Feedback regulation
mechanisms for the control of GTP cyclohydrolase I activity.
Science. 1993;260: 1507
–1510.
Heitzer T, Brockhoff C, Mayer B, Warnholtz A, Mollnau H, Henne S, Meinertz T, Munzel T. Tetrahydrobiopterin improves endothelium-dependent vasodilation in chronic smokers: evidence for a dysfunctional nitric oxide synthase. Circ Res. 2000; 86: E36 –E41.[Medline]
Ishida Y, Todaka K, Kuwahara I, Hashiguchi H, Ishizuka Y, Nakane H, Mitsuyama Y. Peripherally administered tetrahydrobiopterin increases in vivo tryptophan hydroxylase activity in the striatum after transplantation of fetal ventral mesencephalon in six hydroxydopamine lesioned rats. Neurosci Lett. 1998; 253: 45 –48.[CrossRef][Medline]
Ishikawa T, Kondo Y, Goda K, Fujisawa M. Overexpression of
endothelial nitric oxide synthase in transgenic mice accelerates testicular
germ cell apoptosis induced by experimental cryptorchidism. J
Androl. 2005;26: 281
–288.
Kidd GA, Hong H, Majid A, Kaufman DI, Chen AF. Inhibition of brain
GTP cyclohydrolase I and tetrahydrobiopterin attenuates cerebral infarction
via reducing inducible NO synthase and peroxynitrite in ischemic stroke.
Stroke. 2005;36: 2705
–2711.
Kuzkaya N, Weissmann N, Harrison DG, Dikalov S. Interactions of
peroxynitrite, tetrahydrobiopterin, ascorbic acid, and thiols: implications
for uncoupling endothelial nitric-oxide synthase. J Biol
Chem. 2003;278: 22546
–22554.
Lue Y, Sinha Hikim AP, Wang C, Leung A, Swerdloff RS. Functional
role of inducible nitric oxide synthase in the induction of male germ cell
apoptosis, regulation of sperm number, and determination of testes size:
evidence from null mutant mice. Endocrinology. 2003; 144: 3092
–3100.
Masada M, Akino M, Sueoka T, Katoh S. Dyspropterin, an intermediate formed from dihydroneopterin triphosphate in the biosynthetic pathway of tetrahydrobiopterin. Biochem Biophys Acta. 1985; 840: 235 –244.[Medline]
Middendorff R, Müller D, Wichers S, Holstein AF. Evidence for
production and functional activity of nitric oxide in seminiferous tubules and
blood vessels of the human testis. J Clin Endocrinol
Metab. 1997;82: 4154
–4161.
Miller L, Insel T, Scheinin M, Aloi J, Murphy DL, Linnoila M, Lovenberg W. Tetrahydrobiopterin administration to rhesus macaques. Its appearance in CSF and effect on neurotransmitter synthesis. Neurochem Res. 1986; 11: 291 –298.[CrossRef][Medline]
Milstien S, Jaffe H, Kowlessur D, Bonner TI. Purification and
cloning of the GTP cyclohydrolase I feedback regulatory protein, GFRP.
J Biol Chem. 1996; 271: 19743
–19751.
Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J. 1992;6: 3051 –3064.[Abstract]
Peltola V, Huhtaniemi I, Ahotupa M. Abdominal position of the rat testis is associated with high levels of lipid peroxidation. Biol Reprod. 1995;53: 1146 –1150.[Abstract]
Pomerantz DK, Pitelka V. Nitric oxide is a mediator of the
inhibitory effect of activated macrophages on production of androgen by the
Leydig cell of the mouse. Endocrinology. 1998; 139: 922
–931.
Rosenkranz-Weiss P, Sessa WC, Milstien S, Kaufman S, Watson CA, Pober JS. Regulation of nitric oxide synthesis by proinflammatory cytokines in human umbilical vein endothelial cells. Elevations in tetrahydrobiopterin levels enhance endothelial nitric oxide synthase specific activity. J Clin Invest. 1994; 93: 2236 –2243.[Medline]
Rosselli M, Dubey RK, Imthurn B, Macas E, Keller PJ. Effects of
nitric oxide on human spermatozoa: evidence that nitric oxide decreases sperm
motility and induces sperm toxicity. Hum Reprod. 1995; 10: 1786
–1790.
Salgo MG, Pryor WA. Trolox inhibits peroxynitrite-mediated oxidative stress and apoptosis in rat thymocytes. Arch Biochem Biophys. 1996;333: 482 –488.[CrossRef][Medline]
Schott K, Gutlich M, Ziegler I. Induction of GTP-cyclohydrolase I
mRNA expression by lectin activation and interferon-
treatment in human
cells associated with the immune response. J Cell
Physiol. 1993;156: 12
–16.[CrossRef][Medline]
Scott-Burden T, Elizondo E, Ge T, Boulanger CM, Vanhoutte PM. Growth factor regulation of interleukin-1 β-induced nitric oxide synthase and GTP cyclohydrolase expression in cultured smooth muscle cells. Biochem Biophys Res Commun. 1993; 196: 1261 –1266.[CrossRef][Medline]
Setoguchi S, Mohri M, Shimokawa H, Takeshita A. Tetrahydrobiopterin
improves endothelial dysfunction in coronary microcirculation in patients
without epicardial coronary artery disease. J Am Coll
Cardiol. 2001;38: 493
–498.
Shimizu S, Ishii M, Miasaka Y, Wajima T, Negoro T, Hagiwara T, Kiuchi Y. Possible involvement of hydroxyl radical on the stimulation of tetrahydrobiopterin synthesis by hydrogen peroxide and peroxynitrite in vascular endothelial cells. Int J Biochem Cell Biol. 2005; 37: 864 –875.[CrossRef][Medline]
Shimizu S, Shiota K, Yamamoto S, Miyasaka Y, Ishii M, Watabe T, Nishida M, Mori Y, Yamamoto T, Kiuchi Y. Hydrogen peroxide stimulates tetrahydrobiopterin synthesis through the induction of GTP-cyclohydrolase I and increases nitric oxide synthase activity in vascular endothelial cells. Free Radic Biol Med. 2003; 34: 1343 –1352.[CrossRef][Medline]
Shiraishi K, Naito K, Yoshida K. Nitric oxide promotes germ cell
necrosis in the delayed phase after experimental testicular torsion of rat.
Biol Reprod. 2001; 65: 514
–521.
Tiefenbacher CP, Bleeke T, Vahl C, Amann K, Vogt A, Kubler W.
Endothelial dysfunction of coronary resistance arteries is improved by
tetrahydrobiopterin in atherosclerosis. Circulation. 2000; 102: 2172
–2179.
Vasquez-Vivar J, Duquaine D, Whitsett J, Kalyanaraman B,
Rajagopalan S. Altered tetrahydrobiopterin metabolism in atherosclerosis:
implications for use of oxidized tetrahydrobiopterin analogues and thiol
antioxidants. Arterioscler Thromb Vasc Biol. 2002; 22: 1655
–1661.
Wang Y, Newton DC, Miller TL, Teichert AM, Phillips MJ, Davidoff MS, Marsden PA. An alternative promoter of the human neuronal nitric oxide synthase gene is expressed specifically in Leydig cells. Am J Pathol. 2002;160: 369 –380.[Medline]
Welch C, Watson ME, Poth M, Hong T. Francis GL. Evidence to suggest nitric oxide is an interstitial regulator of Leydig cell steroidogenesis. Metabolism. 1995; 44: 234 –238.[CrossRef][Medline]
Werner ER, Werner-Felmayer G, Fuchs D, Hausen A, Reibnegger G, Yim
JJ, Pfleiderer W, Wachter H. Tetrahydrobiopterin biosynthetic activities in
human macrophages, fibroblasts, THP-1, and T 24 cells. GTP-cyclohydrolase I is
stimulated by interferon-
, and 6-pyruvoyl tetrahydropterin synthase and
sepiapterin reductase are constitutively present. J Biol
Chem. 1990;265: 3189
–3192.
Werner-Felmayer G, Prast H, Werner ER, Philippu A, Wachter H. Induction of GTP cyclohydrolase I by bacterial lipopolysaccharide in the rat. FEBS Lett. 1993; 322: 223 –226.[CrossRef][Medline]
Zhao K, Whiteman M, Spencer JP, Halliwell B. DNA damage by nitrite and peroxynitrite: protection by dietary phenols. Methods Enzymol. 2001;335: 296 –307.[Medline]
Zini A, Abitbol J, Schulsinger D, Goldstein M, Schlegel PN. Restoration of spermatogenesis after scrotal replacement of experimentally cryptorchid rat testis: assessment of germ cell apoptosis and eNOS expression. Urology. 1999;53: 223 –227.[CrossRef][Medline]
Zini A, O'Bryan MK, Magid MS, Schlegel PN. Immunohistochemical localization of endothelial nitric oxide synthase in human testis, epididymis, and vas deferens suggest a possible role for nitric oxide in spermatogenesis, sperm maturation, and programmed cell death. Biol Reprod. 1996;55: 935 –941.[Abstract]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |