| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the * Population Council, Center for Biomedical Research, New York, New York.
| Correspondence to: Dr Dolores D. Mruk, Population Council, Center for Biomedical Research, 1230 York Ave, New York, NY 10021 (e-mail: mruk{at}popcbr.rockefeller.edu). |
| Received for publication November 18, 2006; accepted for publication May 7, 2007. |
| Abstract |
|---|
|
|
|---|
- and
ß-catenin as well as with actin, vimentin,
- and ß-tubulin,
and protein kinase C (PKC)-
and -
. Additionally, administration
of Adjudin to adult rats up-regulated the Rab4A level, which coincided with
the loss of spermatocytes, round and elongating/elongated spermatids from the
seminiferous epithelium. More importantly, the ability of Rab4A to associate
with
- and ß-catenin increased during Adjudin-induced junction
restructuring in the testis, illustrating that Rab4A-catenin interactions are
likely to be involved in the disassembly of Sertoli–germ cell contacts.
Taken collectively, these results suggest that Rab4A participates in adherens
junction dynamics.
Key words: Adherens junction, Sertoli cell, germ cell
In this study, we ask whether there is a connection between Rab GTPases and
adherens junction dynamics. We pose this question because the adherens
junction has been shown time and time again to integrate a wide range of
signals to regulate cell adhesion. For instance, the formation of focal
adhesions (cell–extracellular matrix anchoring junctions in which the
cytoplasmic face of cells is linked to actin) as well as cell movement were
affected in Swiss 3T3 cells when the transport of vesicles to and from the
plasma membrane was inhibited by brefeldin A, a fungal metabolite known to
inhibit protein secretion (Bershadsky and
Futerman, 1994). This finding points to the existence of a
relationship between junction integrity, cell movement, and vesicle transport.
In a recently published study, we reported that Rab8B, a GTPase that functions
in the transport of vesicles to the plasma membrane, associated with the
E-cadherin–
-catenin protein complex in Sertoli cells as
determined by chemical crosslinking and immunoprecipitation experiments
(Lau and Mruk, 2003). Also,
the level of Rab8B was observed to increase during the assembly of adherens
junctions in vitro (Lau and Mruk,
2003). While these findings provided early evidence of Rab GTPase
function at the adherens junction, they were not entirely unexpected, because
the participation of Rabs in tight junction dynamics had already been
established in previously published reports
(Sheth et al, 2000;
Marzesco et al, 2002).
Additionally, more recent studies have shown that Rab GTPases coordinate the
internalization of E-cadherin during junction disassembly
(Palacios et al, 2001;
Maxfield and McGraw, 2004;
Lock and Stow, 2005). In this
study, we demonstrate that another Rab family member, Rab4A, has a role
similar to that of Rab8B at the adherens junction. We describe herein the
interaction of Rab4A with
- and ß-catenin—2 adherens
junction signaling proteins that link cadherin to the cytoskeleton—in
the testis. As important, the ability of Rab4A to associate with
- and
ß-catenin increased when the integrity of adherens junctions between
Sertoli and germ cells was compromised by Adjudin (formerly known as AF-2364
or 1-(2,4-dichlorobenzyl)-1H-indazole-3-carbohydrazide)
(Cheng et al, 2001;
Grima et al, 2001;
Mruk and Cheng, 2004). Taken
collectively, these results provide an unprecedented opportunity to expand in
future studies the role of Rab GTPases in cell junction dynamics.
| Methods |
|---|
|
|
|---|
Antibodies and Reagents![]()
The following antibodies were purchased from Santa Cruz Biotechnology Inc
(Santa Cruz, Calif): anti-Rab4A (Catalog No. sc-312, Lot Nos. D0904 and G012),
antiactin (Catalog No. sc-7210, Lot No. G1404, and Catalog No. sc-1616, Lot
No. H2604), anti-vimentin (Catalog No. sc-6260, Lot No. B252, and Catalog No.
sc-5565, Lot No. E012), anti–ß-tubulin (Catalog No. sc-9104, Lot
No. I1602), anti–
-tubulin (Catalog No. sc-10732, Lot No. A311),
anti–protein kinase C (PKC)-
(Catalog No. sc-208, Lot No. H052),
anti–PKC-
(Catalog No. sc-214, Lot No. G192),
anti–E-cadherin (Catalog No. sc-7870, Lot Nos. K080, C212, and G1403),
anti–
-catenin (Catalog No. sc-7894, Lot No. E141), and
anti-integrin ß1 (Catalog No. sc-8978, Lot No. E0203). The following
antibodies were purchased from Invitrogen (Carlsbad, Calif): antioccludin
(Catalog No. 71-1500, Lot No. 11067632), anti–ZO-1 (Catalog No. 33-9100,
Lot Nos. 20269234 and 31085202), anti–ZO-2 (Catalog No. 71-1400, Lot No.
20671338), anti–N-cadherin (Catalog No. 33-3900, Lot Nos. 20671409,
30778768, and 31185680), anti–ß-catenin (Catalog No. 71-2700, Lot
Nos. 11067640 and 30477187), and anti–
-catenin (Catalog No.
13-8500, Lot No. 20772586). In addition, another Rab4A antibody was purchased
from Calbiochem (San Diego, Calif) (Catalog No. 552104, Lot No. D20020).
Secondary antibodies consisted of bovine anti-rabbit, anti-mouse, or anti-goat
immunoglobulin G (IgG) conjugated to horseradish peroxidase (HRP) (Santa
Cruz). Recombinant Rab4A (Catalog No. 552107, Lot No. B20435), which was used
as a positive control in selected immunoblotting experiments, was obtained
from Calbiochem.
Sertoli Cell Cultures![]()
Sertoli cell cultures were prepared from 20-day-old rat testes by
sequential enzymatic treatments (Cheng et
al, 1986; Mruk et al,
2003). Cells were plated at high density (0.75 x
106/cm2) on Matrigel (diluted 1:7 with Ham's F-12
Nutrient Mixture and Dulbecco modified Eagle medium [F-12/DMEM], 1:1; Sigma,
St Louis, Mo)–coated 6-well dishes in F-12/DMEM supplemented with growth
factors as previously described (Cheng et
al, 1986; Mruk et al,
2003). Sertoli cell plating density was determined by obtaining
the volume of sedimented cells following brief centrifugation at 800 x
g. For instance, a packed cell volume of 0.5 mL corresponded to about
180 x 106 Sertoli cells. This ratio was obtained by plating
Sertoli cells isolated from the testes of 10 rats (20 days old) on 100-mm
dishes, followed by a hypotonic treatment on day 2 to yield Sertoli cells with
a purity greater than 98% (Galdieri et al,
1981). Thereafter, Sertoli cells were trypsinized on day 5, the
packed cell volume obtained by centrifugation, and cells counted with a
hemocytometer. This was routinely done over the course of several years to
generate a table to describe the reciprocal relationship between packed
Sertoli cell volume and the number of Sertoli cells isolated. Given that
Sertoli cells are in small aggregates at the time of plating, this is the most
fitting way that we could assess the yield of Sertoli cells isolated and the
plating cell density. For Sertoli cells plated at high density, media were
replaced every 24 hours, and Sertoli cells were incubated for a total of 5
days to allow the assembly of cell junctions to complete. Cells were
terminated on day 6 in immunoprecipitation (IP) lysis buffer (50 mM Tris, pH
7.4, at 22°C containing 0.15 M NaCl, 1% Nonidet P-40 [vol/vol], 10%
glycerol [vol/vol], 2 mM 4-(2-aminoethyl)benzenesulfonyl fluoride [AEBSF], 1
mM EDTA, 100 µM bestatin, 15 µM E-64, 1 µM aprotinin, 1 µM
leupeptin, 1 mM Na3VO4, and 1 mM NaF).
Isolation of Germ Cells![]()
Germ cells were isolated from 90-day-old rat testes as previously described
(Aravindan et al, 1996,
1997). In this study, germ cell
preparations were not exposed to glass wool filtration and thus consisted of
spermatogonia, spermatocytes, round and elongating/elongated spermatids, and
spermatozoa. Germ cell purity was assessed by reverse
transcription–polymerase chain reaction (RT-PCR) and/or immunoblotting
as previously described (Chung and Cheng,
2001; Lee et al,
2004) using putative Sertoli (eg, occludin, testin)
(Grima et al, 1995;
Moroi et al, 1998), Leydig
(eg, 3ß-hydroxysteroid dehydrogenase)
(Baillie and Griffiths, 1964),
and peritubular myoid (eg, alkaline phosphatase and fibronectin)
(Palombi and Di Carlo, 1988)
cell products. Following isolation, germ cells were terminated immediately in
IP lysis buffer or RNA STAT 60 (Tel Test "B," Friendswood,
Tex).
Semiquantitative RT-PCR![]()
Semiquantitative RT-PCR was performed as previously described
(Mruk and Cheng, 1999;
Lau and Mruk, 2003). Primers
used for the amplification of Rab4A
(Zahraoui et al, 1988) and S16
(Chan et al, 1990) were as
follows: 5'–GGAAATGCGGGAACTGGCAAATC–3' (Rab4A sense,
nucleotides 43–65),
5'–CCTGTGCACTTGGAGCCTGTGTAC–3' (Rab4A anti-sense,
nucleotides 605–628),
5'–TCCGCTGCAGTCCGTTCAAGTCTT–3' (S16 sense, nucleotides
15–38), and 5'–GCCAAACTTCTTGGATTCGCAGCG–3' (S16
anti-sense, nucleotides 376–399). To obtain semiquantitative data, Rab4A
and S16 sense primers (approximately 0.2 µg each) were 5'-end-labeled
with [
-32P] adenosine 5'-triphosphate (ATP [specific
activity, 6000 Ci/mmol; Amersham Biosciences Corp, Piscataway, NJ]) by using
T4 polynucleotide kinase (Promega, Madison, WI). Thereafter, labeled primers
were incorporated into PCR reaction tubes, a total of 23 cycles run, and PCR
products visualized by autoradiography. To ensure that the amplifications of
both Rab4A and S16 were in the linear range of cDNA production, a series of
preliminary studies was performed in which different concentrations of Rab4A
and S16 primers were combined with testis cDNA templates for cycling at
different annealing temperatures (Mruk et
al, 1998; Mruk and Cheng,
1999).
Cell and Tissue Lysates, Immunoprecipitation, SDS-PAGE, and Immunoblotting![]()
Cell and tissue lysates were obtained by sonicating samples on ice,
centrifuging suspensions at 15 000 x g, and collecting
supernatants. For immunoprecipitation, protein lysates (eg, 300 µg Sertoli
cell lysate; 500 µg each seminiferous tubule and testis lysates) were
pretreated with normal serum on a rotator, followed by the addition of Protein
A/G PLUS agarose (Santa Cruz). Thereafter, supernatants were incubated with
different antibodies (about 2 µg IgG per sample) as specified.
Immunocomplexes, precipitated by adding Protein A/G PLUS agarose, were washed
extensively with immunoprecipitation wash buffer (50 mM Tris, pH 7.4, at
22°C containing 0.15 M NaCl, 1% Nonidet P-40 [vol/vol], protease and
phosphatase inhibitors). Proteins were extracted from agarose beads by heating
in SDS-sample buffer (0.125 M Tris, pH 6.8, at 22°C containing 1% SDS
[wt/vol], 20% glycerol [vol/vol], and 1.6% ß-mercaptoethanol [vol/vol])
and samples electrophoresed by sodium dodecyl sulfate–polyacrylamide gel
electrophoresis (SDS-PAGE). Following electrophoresis, proteins were
electroblotted onto a nitrocellulose membrane (Schleicher & Schuell,
Keene, NH), nonspecific sites blocked with blocking buffer (6% nonfat milk
[wt/vol] in phosphate-buffered saline [PBS]–Tris buffer [10 mM sodium
phosphate, pH 7.4, at 22°C containing 0.15 M NaCl, 10 mM Tris, and 0.1%
Tween-20 (vol/vol)], and the blot incubated in primary antibody. Thereafter,
the blot was briefly washed with PBS-Tris buffer and incubated in secondary
antibody. Immunoreactive bands were detected by enhanced chemiluminescence.
The Rab4A antibody that was used for immunoprecipitation was obtained from
Calbiochem (Catalog No. 552104, Lot No. D20020). For routine immunoblotting
experiments that did not employ immunoprecipitation, approximately
75–100 µg of protein from cell or tissue lysates was electrophoresed
by SDS-PAGE under reducing conditions and proteins electroblotted onto a
nitrocellulose membrane for immunoblotting as described.
Immunohistochemistry![]()
Adult rats (250–300 g body weight) were killed, testes removed, and
immediately fixed in Bouin's Fixative. Tissues were processed routinely,
embedded in paraffin wax, and blocks cut to generate 5-µm sections.
Immunostaining was performed by using a Histostain-SP kit (Invitrogen) as
instructed by the manufacturer with minor modifications. Sections were
deparaffinized in xylene, rehydrated in descending concentrations of ethanol,
and washed with PBS (10 mM sodium phosphate, pH 7.4, at 22°C containing
0.15 M NaCl). Endogenous peroxidase activity was blocked with 3% hydrogen
peroxide (vol/vol). Thereafter, sections were permeabilized (0.2% Triton X-100
[vol/vol]) and nonspecific sites blocked overnight with 10% nonimmune goat
serum (vol/vol), followed by incubation with anti-Rab4A antibody (1:100
dilution) at room temperature overnight. Sections were then saturated with
biotinylated goat anti-rabbit secondary antibody, followed by
streptavidin-HRP. Immunoreactive Rab4A was visualized by 3-amino-9-ethyl
carbazole (AEC). Sections were counter-stained with hematoxylin and mounted
for microscopy. Images were captured and compiled using Photoshop Software
(version 7.0, Adobe Systems Inc, San Jose, Calif). Controls included
incubating sections with PBS, nonimmune rabbit IgG (1:100 dilution), or an
anti-Rab4A antibody preabsorbed with recombinant Rab4A in place of primary
antibody. Immunostaining was also repeated using frozen sections as previously
described (Lau and Mruk,
2003). In another series of experiments, immunostaining was
performed using paraffin-embedded testes obtained from rats at 12
(blood-testis barrier [BTB] not yet formed), 15 (BTB beginning to form), and
25 days of age (BTB already formed)
(Vitale et al, 1973;
Gilula et al, 1976;
Russell et al, 1989).
Immunofluorescence![]()
Immunofluorescence was performed using Sertoli cells cultured on thermanox
plastic coverslips (Nunc, Rochester, NY) at low (5 x
104/cm2) and high (0.25 x
106/cm2) densities. Cells were terminated on day 5 and
fixed in 3.7% paraformaldehyde (wt/vol). Fixative was removed by successive
washes in PBS, and cells were permeabilized and saturated in 10% nonimmune
goat serum (vol/vol) for 90–120 minutes. Thereafter, Sertoli cells were
incubated in anti-Rab4A antibody (1:300 dilution) containing 1% bovine serum
albumin (BSA) (wt/vol) at room temperature overnight. The following day, cells
were washed and incubated in goat anti-rabbit IgG-fluorescein isothiocyonate
(FITC [1:100 dilution; Invitrogen]) containing 1% nonimmune goat serum
(vol/vol). After washing, cells were mounted using antifade reagent (50%
glycerol [vol/vol] in PBS, pH 7.4, at 22°C containing 0.1% NaN3
[wt/vol]) for microscopy. Controls included incubating cells with PBS or
nonimmune rabbit IgG (1:300 dilution) in place of primary antibody.
Treatment of Rats with Adjudin![]()
A single dose (50 mg/kg body weight) of Adjudin suspended in 0.25%
methylcellulose (wt/vol) was administered to adult rats (250–300 g body
weight, n = 5–7 rats per time point) by gavage as previously described
(Cheng et al, 2001;
Grima et al, 2001). Control
animals received only methylcellulose. Thereafter, rats were killed at
specified time points and testes removed for the preparation of tissue lysates
or paraffin processing.
General Methods![]()
To assess the suitability of the anti-Rab4A antibody for
immunohistochemistry, a series of preliminary experiments was performed by
immunoblotting using 6 different antibodies. In brief, 100 µg testis lysate
was combined with reducing (0.125 M Tris, pH 6.8, at 22°C containing 1%
SDS [wt/vol], 20% glycerol [vol/vol], and 1.6% ß-mercaptoethanol
[vol/vol]) or nonreducing (0.125 M Tris, pH 6.8, at 22°C containing 1% SDS
[wt/vol] and 20% glycerol [vol/vol]) SDS-sample buffer, heated at 100°C,
and electrophoresed by SDS-PAGE. In another set of testis lysates, samples
were processed identically except that heating was omitted prior to
electrophoresis. The antibody that cross-reacted strongly with Rab4A but
minimally with other testicular proteins was used for immunohistochemistry
(Santa Cruz; Catalog No. sc-312, Lot Nos. D0904 or G012). The preabsorbed
Rab4A antibody was obtained by incubating the selected anti-Rab4A antibody
(1:100 dilution) with recombinant Rab4A (0.5 µg). Thereafter,
antibody-antigen immunocomplexes were precipitated by adding anti-rabbit IgG
(whole molecule)–agarose (Sigma) and the supernatant used for
immunohistochemistry. Nonimmune rabbit IgG was prepared by ammonium sulfate
precipitation and diethylaminoethyl (DEAE)-chromatography as previously
described (Cheng et al, 1988;
Page and Thorpe,
2001a,b).
Seminiferous tubules were isolated from 90-day-old rat testes and cultured as
described (Zwain and Cheng,
1994; Lee et al,
2003). Thereafter, tubule cultures were terminated in IP lysis
buffer for the preparation of lysates. In another experiment, staged
seminiferous tubules were isolated by transillumination-assisted dissection
(Parvinen and Vanha-Perttula,
1972; Parvinen and Ruokonen,
1982; Chen et al,
2003). The wave of the seminiferous cycle was dissected into 4
distinct zones: pale (stages IX–XII), weak spot (stages XIII–I),
dark spot (stages II–VI), and long dark (stages VII–VIII). Tubules
were resuspended in IP lysis buffer or RNA STAT 60. Prior to using staged
tubules for Rab4A analysis, RT-PCR was performed using cathepsin L primers as
previously described (Chung et al,
1998; Chen et al,
2003). Because cathepsin L is stage-specific in the testis
(Wright et al, 1995), it was
used as a marker to assess the staging of seminiferous tubules. In selected
experiments, immunoblots were stripped with stripping buffer (62.5 mM Tris, pH
6.7, at 22°C containing 100 mM ß-mercaptoethanol and 2% SDS [wt/vol])
and reprobed with another primary antibody. Protein concentration was
determined by Coomassie blue dye-binding assay using BSA as a standard
(Bradford, 1976). The
authenticity of the Rab4A PCR product was verified by nucleotide sequencing
using Sequenase (Cheng et al,
1988). Statistical analyses were performed by either Student's
t test or analysis of variance using InStat Software (version 3.01;
Graph Pad Software Inc, San Francisco, Calif). Densitometric scanning was
performed using QuantiScan Software (version 3.0; Biosoft, Ferguson, Mo). All
experiments reported in this paper were repeated 3–5 times.
| Results |
|---|
|
|
|---|
|
|
Rab4A Coimmunoprecipitates With Cell Junction Proteins![]()
To determine whether Rab4A associates with adherens and tight junction
proteins, a series of immunoprecipitation experiments was performed. When
Sertoli cell, seminiferous tubule, and testis lysates were used for
immunoprecipitation in conjunction with different antibodies, Rab4A was found
to interact with actin, vimentin,
-(weakly) and ß-tubulin, and
- and ß-catenin but not with
-tubulin, occludin, ZO-1,
ZO-2, E- and N-cadherin,
-catenin, and integrin ß1
(Figure 3). Rab4A was also
found to associate with PKC-
and -
(weakly)
(Figure 3). As a control,
anti-Rab4A antibody was used for immunoprecipitation, followed by
immunoblotting with the same antibody. This simply demonstrated that the Rab4A
antibody used in this study was suitable for subsequent immunoprecipitation
experiments. Also, each immunoblot contained an additional control—that
is, Sertoli cell lysate (without immunoprecipitation) electrophoresed under
reducing conditions and probed with the corresponding antibody as listed to
the left of the control (Ctrl) column of
Figure 3. Notably, the results
shown in Figure 3 are not
quantitative because antibody titers, the concentrations of different
antibodies, and the amounts of protein lysates used for immunoprecipitation
were not constant.
|
Rab4A and Adjudin-Mediated Restructuring of the Seminiferous Epithelium![]()
The level of Rab4A in the testis was investigated following administration
of Adjudin. Adjudin is a chemical entity that shares structural similarities
with lonidamine (1-(2,4)-dichlorobenzyl-1H-indazole-carboxylic acid), which is
known to severely damage stress fibers (eg, actin filaments) in Sertoli cells
(De Martino et al, 1981;
Silvestrini et al, 1984). The
primary manifestation resulting from Adjudin treatment is the depletion of
virtually all germ cell types except spermatogonia and primary spermatocytes,
which reside outside of the BTB (Cheng et
al, 2001; Grima et al,
2001). If 1) the contribution made by germ cells to the overall
Rab4A level in the control testis (Figure
1C) and 2) the loss of germ cells following Adjudin administration
are collectively taken into account, the level of Rab4A increased
significantly during Adjudin-induced cell junction restructuring
(Figure 4A and B). Because
Rab4A immunoreactivity in the seminiferous epithelium is largely restricted to
Sertoli cells, which have an elaborate cytoskeleton
(Russell, 1993), and Adjudin
is proposed to target stress fibers, we have continued along this line of
investigation and probed for changes in the localization of Rab4A using
cross-sections from Adjudin-treated rat testes. The localization of
immunoreactive Rab4A in the control testis
(Figure 4C, arrows) was
consistent with results shown in Figure 2A
through G. However, 7 days after Adjudin treatment, when cell
junctions between remaining secondary spermatocytes and Sertoli cells were
breaking down, Rab4A immunoreactivity did not localize to the Sertoli cell
stalk but to the acrosome of remaining germ cells
(Figure 4D versus C). Similar
results were seen 14 days after treatment
(Figure 4E versus C,
arrowheads). Leydig cells remained strongly immunoreactive for Rab4A following
Adjudin administration (Figure 4D and E
versus C).
|
|
- and ß-catenin antibodies, there was a statistically
significant increase in the amount of
- and ß-catenin
coimmunoprecipitating with Rab4A, from 4 hours to 2 days and from 1 to 2 days,
respectively (Figure 5A and B).
Although Rab4A did not coimmunoprecipitate with cadherin when lysates from
control testes were used (Figure
3), we proceeded nevertheless to examine whether Rab4A establishes
an association with this cell adhesion protein during junction restructuring.
Following Adjudin administration, however, no association was found to exist
between Rab4A–E-cadherin or Rab4A–N-cadherin (data not shown). As
a control, immunoprecipitation and immunoblotting were performed with an
anti-Rab4A antibody using testes lysates following Adjudin treatment
(Figures 5A, top panel). IgG
served as an indicator of equal protein processing and loading onto gels
(Figure 5A, bottom panel). | Discussion |
|---|
|
|
|---|
Even though our understanding of endocytosis continues to grow at an
exceedingly rapid rate, little is currently known about how this process and
its regulatory molecules connect functionally with the cytoskeleton. For
example, several cytoskeleton-associated proteins such as actin, tubulin,
kinesin, and dynein (Pol et al,
1997; Qualmann et al,
2000) have been linked to the endosomal system as well as to Rab
GTPase function, but the mechanisms controlling these interactions are largely
unknown. In this study, we report that Rab4A physically associated with actin
filaments and microtubules. This has been supported in part by Bielli and
colleagues (2001), who
demonstrated that Rab4A localizes to microtubules in HeLa cells. Whether Rab4A
connects to the actin cytoskeleton directly or via scaffolding proteins (eg,
-actinin, gelsolin, vinculin, and espin) has not yet been completely
addressed by any single study. However, we report herein the existence of a
direct as well as an indirect interaction between Rab4A and actin via
-
and ß-catenin, respectively. When these results are interpreted in the
context of Rab4A function, they ultimately suggest that protein-protein
interactions that underlie adherens junction function are not static, an
observation that has been supported time and time again by different in vitro
and in vivo systems (Mruk and Cheng,
2004; Erez et al,
2005; Palacios et al,
2005).
When a single dose of Adjudin was administered in vivo as a means to induce
extensive Sertoli–germ cell junction disassembly, the level of Rab4A
remained fairly constant at first examination. However, immunoblotting results
have shown that the level of Rab4A in germ cells is comparable to that in
Sertoli cells. Thus, Adjudin-mediated loss of germ cells from the seminiferous
epithelium should in fact result in a significant decrease in the testicular
Rab4A level. Instead, a surge in Rab4A was noted, implicating Rab4A in the
events of junction restructuring. Additionally, the increase in
Rab4A–
-catenin and Rab4A–ß-catenin
coimmunoprecipitation after Adjudin treatment suggests that these adaptor
proteins are possibly moving away from the adherens junction and associating
with the early endosome of which Rab4A is a marker. Indeed, ß-catenin was
found to dissociate from N-cadherin following Adjudin administration
(Xia and Cheng, 2005). It
should also be noted that the levels of
- and ß-catenin do not
decrease following Adjudin administration, even when virtually all
Sertoli–germ cell adhesive contacts have been disassembled. These
results seemingly suggest that during junction disassembly early
endosome-associated catenin is possibly being trafficked to the recycling
endosome. Because many germ cells have depleted the seminiferous epithelium 1
week after Adjudin treatment, the need for the BTB to disassemble transiently
to allow for the entry of preleptotene spermatocytes into the adluminal
compartment may not exist any longer. Thus, this may explain why a loss of
Rab4A immunoreactivity was detected in the basal compartment of Sertoli cells
following Adjudin administration. However, we do not know exactly why an
immunoreactive signal corresponding to Rab4A would be found in the acrosome of
remaining germ cells. Taken collectively, these results suggest that Rab4A
likely participates in the restructuring of adherens junctions in the testis.
As the number of studies reporting endocytosis-related cellular phenomena
increases in coming years, it will be interesting to discover how Rab4A
participates in cell junction dynamics in the seminiferous epithelium as well
as in other epithelia.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Aravindan GR, Mruk D, Lee WM, Cheng CY. Identification, isolation,
and characterization of a 41-kilodalton protein from rat germ cell-conditioned
medium exhibiting concentration-dependent dual biological activities.
Endocrinology. 1997; 138: 3259
-3268.
Aravindan GR, Pineau C, Bardin CW, Cheng CY. Ability of trypsin in mimicking germ cell factors that affect Sertoli cell secretory function. J Cell Physiol. 1996; 168: 123 -133.[CrossRef][Medline]
Baillie AH, Griffiths K. 3ß-Hydroxysteroid dehydrogenase activity in the mouse Leydig cell. J Endocrinol. 1964; 29: 9 -17.[Medline]
Beaver BV, Reed W, Leary S, McKiernan B, Bain F, Schultz R, Bennett BT, Pascoe P, Shull E, Cork LC, Francis-Floyd R, Amass KD, Johnson R, Schmidt RH, Underwood W, Thorton GW, Kohn B. 2000 Report of the AVMA Panel on Euthanasia. JAVMA. 2001; 218: 669 -696.[Medline]
Bershadsky AD, Futerman AH. Disruption of the Golgi apparatus by
brefeldin A blocks cell polarization and inhibits directed cell migration.
Proc Natl Acad Sci U S A. 1994; 91: 5686
-5689.
Bielli A, Thornqvist PO, Hendrick AG, Finn R, Fitzgerald K, McCaffrey MW. The small GTPase Rab4A interacts with the central region of cytoplasmic dynein light intermediate chain-1. Biochem Biophys Res Commun. 2001;281: 1141 -1153.[CrossRef][Medline]
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976; 72: 248 -254.[CrossRef][Medline]
Braga VMM. Cell-cell adhesion and signaling. Curr Opin Cell Biol. 2002;14: 546 -556.[CrossRef][Medline]
Bryant DM, Stow JL. The ins and outs of E-cadherin trafficking. Trends Cell Biol. 2004; 14: 427 -434.[CrossRef][Medline]
Chan YL, Paz V, Olvera J, Wool IG. The primary structure of rat ribosomal protein S16. FEBS Lett. 1990; 263: 85 -88.[CrossRef][Medline]
Chen YM, Lee NPY, Mruk DD, Lee WM, Cheng CY. Fer kinase/Fer
T and adherens junction dynamics in the testis: an in vitro and in
vivo study. Biol Reprod. 2003; 69: 656
-672.
Cheng CY, Chen CL, Feng ZM, Marshall A, Bardin CW. Rat clusterin isolated from primary Sertoli cell enriched culture medium is sulfated glycoprotein-2 (SGP-2). Biochem Biophys Res Commun. 1988; 155: 398 -404.[CrossRef][Medline]
Cheng CY, Mather JP, Byer AL, Bardin CW. Identification of
hormonally responsive proteins in primary Sertoli cell culture medium by
anion-exchange high performance liquid chromatography.
Endocrinology. 1986; 118: 480
-488.
Cheng CY, Mathur PP, Grima J. Structural analysis of clusterin and its subunits in ram rete testis fluid. Biochemistry. 1988; 27: 4079 -4088.[CrossRef][Medline]
Cheng CY, Mruk DD. Cell junction dynamics in the testis:
Sertoligerm cell interactions and male contraceptive development.
Physiol Rev. 2002; 82: 825
-874.
Cheng CY, Silvestrini B, Grima J, Mo MY, Zhu LJ, Johansson E, Saso
L, Leone MG, Palmery M, Mruk D. Two new male contraceptives exert their
effects by depleting germ cells prematurely from the testis. Biol
Reprod. 2001;65: 449
-461.
Chung NPY, Cheng CY. Is cadmium chloride-induced inter-Sertoli
tight junction permeability barrier disruption a suitable in vitro model to
study the events of junction disassembly during spermatogenesis in the rat
testis? Endocrinology. 2001; 142: 1878
-1888.
Chung SS, Zhu LJ, Mo MY, Silvestrini B, Lee WM, Cheng CY. Evidence
for cross-talk between Sertoli and germ cells using selected cathepsins as
markers. J Androl. 1998; 19: 686
-703.
De Martino C, Malcorni W, Bellocci M, Floridi A, Marcante ML. Effects of AF1312 TS and lonidamine on mammalian testis. A morphological study. Chemotherapy. 1981; 27(suppl 2): 27 -42.[CrossRef][Medline]
Erez N, Bershadsky A, Geiger B. Signaling from adherens-type junctions. Eur J Cell Biol. 2005; 84: 235 -244.[CrossRef][Medline]
Galdieri M, Ziparo E, Palombi F, Russo MA, Stefanini M. Pure Sertoli cell cultures: a new model for the study of somatic-germ cell interactions. J Androl. 1981; 5: 249 -259.
Gilula NB, Fawcett DW, Aoki A. The Sertoli cell occluding junctions and gap junctions in mature and developing mammalian testis. Dev Biol. 1976;50: 142 -168.[CrossRef][Medline]
Grima J, Silvestrini B, Cheng CY. Reversible inhibition of
spermatogenesis in rats using a new male contraceptive,
1-(2,4-dichlorobenzyl)-indazole-3-carbohydrazide. Biol
Reprod. 2001;64: 1500
-1508.
Grima J, Zhu LJ, Zong SD, Catterall JF, Bardin CW, Cheng CY. Rat testin is a newly identified component of the junctional complexes in various tissues whose mRNA is predominantly expressed in the testis and ovary. Biol Reprod. 1995; 52: 340 -355.[Abstract]
Korobko E, Kiselev S, Olsnes S, Stenmark H, Korobko I. The Rab5
effector Rabaptin-5 and its isoform Rabaptin-5
differ in their ability
to interact with the small GTPase Rab4. FEBS J. 2005; 272: 37
-46.[CrossRef][Medline]
Lau ASN, Mruk DD. Rab8B GTPase and junction dynamics in the testis.
Endocrinology. 2003; 144: 1549
-1563.
Lee NPY, Mruk DD, Conway AM, Cheng CY. Zyxin, axin, and
Wiskott-Aldrich syndrome protein are adaptors that link the cadherin/catenin
protein complex to the cytoskeleton at adherens junctions in the seminiferous
epithelium of the rat testis. J Androl. 2004; 25: 200
-215.
Lee NPY, Mruk D, Lee WM, Cheng CY. Is the cadherin/catenin complex
a functional unit of cell-cell-actin-based adherens junctions (AJ) in the rat
testis? Biol Reprod. 2003; 68: 489
-508.
Lock JG, Stow JL. Rab11 in recycling endosomes regulates the
sorting and basolateral transport of E-cadherin. Mol Biol
Cell. 2005; 16: 1744
-1755.
Marzesco AM, Dunia I, Pandjaitan R, Recouvreur M, Dauzonne D,
Benedetti EL, Louvard D, Zahraoui A. The small GTPase Rab13 regulates assembly
of functional tight junctions in epithelial cells. Mol Biol
Cell. 2002;13: 1819
-1831.
Maxfield FR, McGraw TE. Endocytic recycling. Nat Rev Mol Cell Biol. 2004;5: 121 -132.[CrossRef][Medline]
Mays RW, Beck KA, Nelson WJ. Organization and function of the cytoskeleton in polarized epithelial cells: a component of the protein sorting machinery. Curr Opin Cell Biol. 1994; 6: 16 -24.[CrossRef][Medline]
Moroi S, Saitou M, Fujimoto K, Sakakibara A, Furuse M, Yoshida O, Tsukita S. Occludin is concentrated at tight junctions of mouse/rat but not human/guinea pig Sertoli cell testes. Am J Physiol. 1998; 274: C1708 -C1717.[Medline]
Mruk D, Cheng CH, Cheng YH, Mo MY, Grima J, Silvestrini B, Lee WM,
Cheng CY. Rat testicular extracellular superoxide dismutase
(SODEX): its purification, cellular distribution, and regulation.
Biol Reprod. 1998; 59: 298
-308.
Mruk D, Cheng CY. Sertolin is a novel gene marker of cell-cell
interactions in the rat testis. J Biol Chem. 1999; 274: 27056
-27068.
Mruk DD, Cheng CY. Sertoli-Sertoli and Sertoli-germ cell
interactions and their significance in germ cell movement in the seminiferous
epithelium during spermatogenesis. Endocr Rev. 2004; 25: 747
-806.
Mruk DD, Siu MKY, Conway AM, Lee NPY, Lau ASN, Cheng CY. Role of
tissue inhibitor of metalloproteases-1 in junction dynamics in the testis.
J Androl. 2003;24: 510
-523.
Nagelkerken B, Van Anken E, Van Raak M, Gerez L, Mohrmann K, Van Uden N, Holthuizen J, Pelkmans L, Van der Sluijs P. Rabaptin4, a novel effector of the small GTPase Rab4A, is recruited to perinuclear recycling vesicles. Biochem J. 2000; 346: 593 -601.[CrossRef][Medline]
Page M, Thorpe R. Purification of IgG by precipitation with sodium sulfate or ammonium sulfate. In: Walker JM, ed. The Protein Protocols Handbook. Totowa, NJ: Humana Press; 2001a: 983 -984.
Page M, Thorpe R. Purification of IgG using DEAE-Sepharose chromatography. In: Walker JM, ed. The Protein Protocols Handbook. Totowa, NJ: Humana Press; 2001b: 987 -988.
Palacios F, Price L, Schweitzer J, Collard JG, D'Souza-Schorey C. An essential role for ARF6-regulated membrane traffic in adherens junction turnover and epithelial cell migration. EMBO J. 2001; 20: 4973 -4986.[CrossRef][Medline]
Palacios F, Tushir JS, Fujita Y, D'Souza-Schorey C. Lysosomal
targeting of E-cadherin: a unique mechanism for the down-regulation of
cell-cell adhesion during epithelial to mesenchymal transitions.
Mol Cell Biol. 2005; 25: 389
-402.
Palombi F, Di Carlo C. Alkaline phosphatase is a marker for myoid cells in cultures of rat peritubular and tubular tissue. Biol Reprod. 1988;39: 1101 -1109.[Abstract]
Parvinen M, Ruokonen A. Endogenous steroids in the rat seminiferous tubules. Comparison of the stages of the epithelial cycle isolated by transillumination-assisted microdissection. J Androl. 1982; 3: 211 -220.[Abstract]
Parvinen M, Vanha-Perttula T. Identification and enzyme quantification of the stages of the seminiferous epithelial wave in the rat. Anat Rec. 1972; 174: 435 -450.[CrossRef][Medline]
Perez-Moreno M, Jamora C, Fuchs E. Sticky business: orchestrating cellular signals at adherens junctions. Cell. 2003; 112: 535 -548.[CrossRef][Medline]
Pol A, Ortega D, Enrich C. Identification of cytoskeleton-associated proteins in isolated rat liver endosomes. Biochem J. 1997; 327: 741 -746.[Medline]
Qualmann B, Kessels NM, Kelly RB. Molecular links between
endocytosis and the actin cytoskeleton. J Cell Biol. 2000; 150: F111
-F116.
Russell LD. Form, dimensions, and cytology of mammalian Sertoli cells. In: Russell LD, Griswold MD, eds. The Sertoli Cell. Clearwater, Fla: Cache River Press; 1993: 1 -37.
Russell LD, Bartke A, Goh JC. Postnatal development of the Sertoli cell barrier, tubular lumen, and cytoskeleton of Sertoli and myoid cells in the rat, and their relationship to tubular fluid secretion and flow. Am J Anat. 1989; 184: 179 -189.[CrossRef][Medline]
Seabra MC, Coudrier E. Rab GTPases and myosin motors in organelle motility. Traffic. 2004; 5: 393 -399.[CrossRef][Medline]
Seachrist JL, Ferguson SSG. Regulation of G-protein coupled receptor endocytosis and trafficking by Rab GTPases. Life Sci. 2003;74: 225 -235.[CrossRef][Medline]
Sheth B, Fontaine JJ, Ponza E, McCallum A, Page A, Citi S, Louvard D, Zahraoui A, Fleming TP. Differentiation of the epithelial apical junctional complex during mouse preimplantation development: a role for Rab13 in the early maturation of the tight junction. Mech Dev. 2000; 97: 93 -104.[CrossRef][Medline]
Silvestrini B, Palazzo G, De Gregorio M. Lonidamine and related compounds. Prog Med Chem. 1984; 21: 110 -135.[Medline]
Somsel Rodman J, Wandinger-Ness A. Rab GTPases coordinate
endocytosis. J Cell Sci. 2000; 113: 183
-192.
Stenmark H, Olkkonen VM. The Rab GTPase family. Genome Biol. 2001;2: 3007.3001 -3007.3007.
Takai Y, Sasaki T, Matozaki T. Small GTP-binding proteins. Physiol Rev
. 2001;81: 153
-208.
Vitale G, Rybin V, Christoforidis S, Thornqvist PO, McCaffrey M, Stenmark H, Zerial M. Distinct Rab-binding domains mediate the interaction of rabaptin-5 with GTP-bound Rab4 and Rab5. EMBO J. 1998; 17: 1941 -1951.[CrossRef][Medline]
Vitale R, Fawcett DW, Dym M. The normal development of the blood-testis barrier and the effects of clomiphene and estrogen treatment. Anat Rec. 1973; 176: 333 -344.[CrossRef]
Wright WW, Zabludoff SD, Penttila TL, Parvinen M. Germ cell-Sertoli cell interactions: regulation by germ cells of the stage-specific expression of CP-2/cathepsin L mRNA by Sertoli cells. Dev Genet. 1995; 16: 104 -113.[CrossRef][Medline]
Xia W, Cheng CY. TGF-ß3 regulates anchoring junction dynamics in the seminiferous epithelium of the rat testis via the Ras/ERK signaling pathway: an in vivo study. Dev Biol. 2005; 280: 321 -343.[CrossRef][Medline]
Yeaman C, Grindstaf KK, Nelson WJ. New perspectives on mechanisms
involved in generating epithelial cell polarity. Physiol
Rev. 1999;79: 73
-98.
Zahraoui A, Touchot N, Chardin P, Tavitian A. Complete coding
sequences of the Ras related Rab 3 and 4 cDNAs. Nucleic Acids
Res. 1988;16: 1204
.
Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev Mol Cell Biol . 2001; 2: 107 -117.[CrossRef][Medline]
Zwain IH, Cheng CY. Rat seminiferous tubular culture medium contains a biological factor that inhibits Leydig cell steroidogenesis: its purification and mechanism of action. Mol Cell Endocrinol. 1994;104: 213 -227.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
D. D. Mruk and A. S.N. Lau RAB13 Participates in Ectoplasmic Specialization Dynamics in the Rat Testis Biol Reprod, March 1, 2009; 80(3): 590 - 601. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Mruk, B. Silvestrini, and C. Y. Cheng Anchoring Junctions As Drug Targets: Role in Contraceptive Development Pharmacol. Rev., June 1, 2008; 60(2): 146 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Schwartz, C. Cao, O. Pylypenko, A. Rak, and A. Wandinger-Ness Rab GTPases at a glance J. Cell Sci., November 15, 2007; 120(22): 3905 - 3910. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |