| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas.
| Correspondence to: Dr Gail A. Cornwall, Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, TX 79430 (e-mail: gail.cornwall{at}ttuhsc.edu). |
| Received for publication April 13, 2006; accepted for publication June 30, 2006. |
| Abstract |
|---|
|
|
|---|
Key words: Steroid hormones, cystatin, gonadotrope, anterior pituitary gland
The prohormone convertases are a family of calcium-dependent proteases that function within the secretory pathway and cleave proproteins at mono- or dibasic sites to generate biologically active proteins (Bergeron et al, 2000). Substrates for convertases include the precursors of neural and peptide hormones, cell surface receptors, growth factors, and cell adhesion molecules. Of the 7 prohormone convertase family members, PC1, PC2, and PC4 are primarily found within the neuroendocrine and reproductive systems, respectively, while other family members including furin, PC5/6, PACE4, and PC7/8 exhibit broader patterns of expression. Although convertases may cleave the same substrate in vitro, in vivo the substrate specificity and efficiency of these proteases are thought to be governed not only by the levels of expression of a particular convertase but also by the levels of endogenous inhibitors and by the presence of cell-specific chaperones (Berman et al, 1999). Thus, one possible role for CRES may be to regulate important proprotein processing events in the reproductive and neuroendocrine systems.
CRES is expressed in the proximal caput epididymal epithelium (Cornwall et al, 1992), round spermatids in the testis (Cornwall and Hann, 1995), anterior pituitary gonadotropes (Sutton et al, 1999), and corpora lutea in the ovary (Hsia and Cornwall, 2003). Within gonadotropes, CRES is packaged into secretory granules of the regulated secretory pathway (Sutton et al, 1999), which contain luteinizing hormone (LH) as well as known prohormone convertase substrates, including secretogranin, chromogranin, prodynorphin, and pituitary adenylate cyclase activating peptide (PACAP) (Koves et al, 1998; Laslop et al, 1998; Berman et al, 1999). Prohormone convertase mRNAs that are expressed in the gonadotropes include PC1, PC2, furin, PC6, and PACE4 (Dong and Day, 2002). Several of the secretory granule proteins that are released with LH and CRES are thought to be involved in the autocrine/paracrine feedback regulation of gonadotropes (Sion et al, 1988; Dragatsis et al, 1995; Tsujii and Winters, 1995). The presence of CRES exclusively within gonadotropes and the fact that it inhibits PC2 but not PC1 (Cornwall et al, 2003) suggest that CRES could be a mechanism to regulate the specificity of hormone processing enzymes within these cells and ultimately feedback activity. The need to tightly control protease activities within neuroendocrine cells is demonstrated by the phenotype of mice null for 7B2, a chaperone and inhibitor of PC2, which consists of multiple endocrine defects resulting from incorrect prohormone processing (Westphal et al, 1999).
Previous experiments from our laboratory demonstrated that within male mouse gonadotropes, intracellular levels of CRES protein varied in concert with LH following castration and testosterone replacement, supporting the idea that CRES might play an integral role in regulating gonadotrope secretion (Sutton et al, 1999). The secretion of gonadotropins from the anterior pituitary gland is a tightly controlled process regulated by the complex interactions of the hypothalamicpituitary-gonadal (HPG) axis. The pulsatile release of gonadotropin-releasing hormone (GnRH) from the hypothalamus regulates the synthesis and secretion of the gonadotropin LH as well as various autocrine/paracrine factors from the gonadotrope cell. In the male, LH regulates the synthesis and secretion of testosterone from testicular Leydig cells, which in turn can elicit negative feedback either directly at the level of the pituitary gland gonadotropes or indirectly by regulating GnRH release from the hypothalamus. The experiments presented herein were designed to examine in the male mouse the regulation of Cres mRNA and protein steady state levels by components of the HPG axis to identify the hormonal conditions in which Cres is up- or down-regulated, thus providing clues regarding its physiological role in gonadotropes. The levels of LHß mRNA and protein were also determined and served as indicators of the hormonal state of the animal following the various treatments, while serum LH was examined as a measure of gonadotrope secretory activity.
| Materials and Methods |
|---|
|
|
|---|
Hormonal Treatments![]()
Castration and Steroid Maintenance
Orchiectomies were by the scrotal route under ketamine/xylazine anesthesia.
To examine variation in pituitary Cres and LHß mRNA levels
between individual mice, the pituitary glands from 7 intact mice and 3 mice
bilaterally castrated for 7 days were removed for isolation of RNA and reverse
transcription polymerase chain reaction (RT-PCR) analysis. In castration and
hormonal maintenance studies, hormonal maintenance was begun at the time of
castration and included daily subcutaneous injections of vehicle (sham and
castrate), 25 µg testosterone propionate
(Naik et al 1984;
Fallest et al, 1995), 25 µg
5
-androstan-17ß-ol-3-one (DHT)
(Fallest et al, 1995), or 300
ng 17ß-estradiol (E2)
(Fallest et al, 1995) in 100
µL sesame oil (Sigma Chemical Co, St. Louis, Mo) for 1 week. Animals
(810 mice/group) were euthanized on the day following the final
injections; 67 pituitary glands were pooled for preparation of RNA and
subsequent RT-PCR analysis and 23 pituitary glands processed for
immunohistochemistry. The castration and hormone replacement experiments were
repeated with an additional 810 mice/treatment group, and both sets of
data are shown.
Antide Studies Antide, a GnRH antagonist (Bachem California, Torrance, Calif), was solubilized in water (1 mg/mL) and then diluted to 0.6 mg/mL in a final solution of 0.9% NaCl/20% propylene glycol and stored at 80°C until use. Animals were castrated and given subcutaneous injections of the appropriate combination of vehicle(s) and hormone treatment(s): oil + saline/propylene glycol (castrate); oil + Antide (60 µg) (Fallest et al, 1995); or DHT (25 µg) + Antide. Animals were euthanized on the day following the final injections. The pituitary glands from 67 mice in each treatment group (810 mice/group) were pooled for preparation of RNA and RT-PCR analysis, while 23 pituitary glands were processed for immunohistochemistry. To examine the effect of Antide on Cres mRNA levels over time, intact mice were given 1 injection of Antide (60 µg) and killed 4, 12, and 24 hours later. The pituitary glands from mice in each group (67 mice/group) were pooled for preparation of RNA and RT-PCR analysis. Both Antide experiments were repeated with an additional 610 mice/treatment group, and both sets of data are shown.
Organ Culture To examine the effect of steroid hormones on Cres expression in vitro, pituitary glands from intact male mice were hemisected and placed directly into a 24-well plate (36 pituitary sections/well) containing 0.5 mL DMEM with high glucose (Invitrogen, Carlsbad, Calif) and 0.05% ethanol (vehicle), 10 nM E2 (Ravindra and Aronstam, 1992; Muyan et al, 1993; Shupnik, 1996), or 10 nM DHT (Muyan and Baldwin, 1992; Muyan et al, 1993) and cultured for 6 hours in the absence of serum. To examine the effect of GnRH treatment on Cres expression in vitro, hemisected pituitary glands were placed into a 24-well plate (36 sections/well) containing 0.5 mL DMEM with high glucose and treated with 10 nM GnRH in PBS (Sigma) in 5-minute pulses every 45 minutes (Weiss et al, 1990; Cassina et al, 1997) with a pulse at the beginning of culture and the glands harvested immediately after 9 pulses (6 hours), a protocol that has been shown to stimulate transcription of LHß (Shupnik, 1996). For all incubations, the 24-well tissue culture plates were placed into a large plastic dish that was then placed in a 37°C shaking water bath to facilitate gas exchange with room air by agitation. To control for the possible effect of multiple media changes in the GnRH studies, pituitary glands in all treatment groups were given fresh changes of the appropriate media coincident with GnRH pulses. At the end of the 6-hour culture period, pituitary glands from each treatment group were placed directly into Trizol reagent for RNA preparation. Also, 1 group of pituitary glands was placed directly into Trizol reagent after removal from the animal to serve as an in vivo control group. The organ culture experiments were repeated on 3 separate occasions using 36 pituitary sections/treatment.
Semiquantitative RT-PCR![]()
Because of the small amount of total RNA extracted from an individual mouse
pituitary gland and the necessity for multiple replicate RT-PCR reactions of
each primer pair, including noreverse-transcription (RT) controls, for
most experiments pituitary glands were pooled from 67 mice in each
treatment group and total RNA isolated using Trizol reagent (Invitrogen)
following the manufacturer's protocol. All animal experiments were repeated.
The RNA was quantitated by A260/A280 and visualized by
gel electrophoresis in 1% agarose gel containing borate buffer (pH 8.2) and
0.66 M formaldehyde. For RT-PCR, 2.5 µg total RNA was incubated in a RT
reaction buffer containing 5 mM MgCl2, 50 mM KCl, 10 mM Tris (pH
8.3), 0.5 mM deoxynucleotide triphosphates, 20 U RNasin (RNase inhibitor,
Promega, Madison, Wis), and 2.5 µM oligo-dT (Promega) in a final volume of
25 µL for 30 minutes at 37°C in the presence of 2.5 U RNase-free DNase
I (Roche, Indianapolis, Ind). After heat inactivation of DNase I at 75°C
for 5 minutes (Huang et al,
1996), an aliquot was reserved for PCR amplification as a no-RT
control to confirm the absence of contaminating DNA. Then 50 U MuLV reverse
transcriptase (Perkin-Elmer Biosystems, Foster City, Calif) was added to the
remainder, and reverse transcription was carried out at 42°C for 30
minutes, 99°C for 5 minutes, and 5°C for 5 minutes.
Three µL of each RT and no-RT reaction was amplified by PCR in separate
reactions using primers recognizing Cres, LHß, and GAPDH cDNAs.
LHß was amplified as a biological control in each experiment, and GAPDH
was amplified as a constitutive control to measure the relative efficiency of
each RT reaction. The identity of PCR products generated with each primer pair
was confirmed by sequence analysis. PCR master mixes containing 10 mM Tris (pH
8.3), 50 mM KCl, 0.5 µM each of forward and reverse primers, 0.25 µCi
[
-32P] dCTP, and 1.25 U Taq DNA polymerase (Sigma) were
prepared so that RNA samples from each treatment group within a particular
experiment were amplified from a single master mix. MgCl2 and dNTP
concentrations, as well as cycle number, were optimized for each set of
primers. Specifically, to determine that amplification by PCR was within the
exponential phase, identical RT-PCR reactions containing pooled pituitary
gland RNA were amplified for increasing cycle numbers in the presence of
[
-32P] dCTP for each primer pair and analyzed by agarose
electrophoresis. Amplification with each primer set produced cycle-number
dependent increases in the amount of PCR product (data not shown). For each
primer pair, a cycle number in the middle of the exponential phase was chosen
so that differences could be detected in either direction.
Cres PCR reactions were carried out in 2.5 mM MgCl2 and 0.25 mM dNTPs for 40 cycles. LHß reactions consisted of 2 mM MgCl2 and 0.3 mM dNTPs for 30 cycles, and GAPDH reactions were amplified using 2 mM MgCl2 and 0.2 mM dNTPs for 26 cycles. The cycling parameters consisted of 45 seconds at 95°C for denaturation, 25 seconds annealing at Ta for each primer set, and 1 minute at 72µC for extension, after which the reactions were incubated at 72°C for 7 minutes using a minicycler (MJ Research, Inc, Watertown, Mass). RT-PCR products were then analyzed by electrophoresis in 1.5% agarose/1 x Tris/acetate/EDTA gels, which were dried under vacuum onto filter paper for 2 hours at 50°C. The dried gel was then exposed to a Phosphorimager (Molecular Dynamics, Sunnyvale, Calif), and integrated optical densities (IOD) were generated based on the amount of radioactivity using ImageQuant (Molecular Dynamics). The integrated optical densities for Cres and LHß were normalized to that of GAPDH.
For each animal experiment, 46 RT-PCR replicates were performed on
each RNA preparation on separate occasions. The absolute values of the IODs of
corresponding PCR reactions in different RT-PCR replicates varied considerably
due to differences in the age of the radioisotope, the exposure time on the
Phosphoimager, and radioisotope incorporation efficiency. Therefore, for each
RT-PCR replicate, we calculated a modified Z score for each PCR reaction by
dividing the IOD from each PCR reaction by the average of all IODs for that
primer pair, ie, for n treatments, Zn = yn/(
yn)/n. The validity of this transformation was verified by ensuring
that the standard deviations of transformed values within a PCR replicate were
not statistically different (one-way analysis of variance [ANOVA]) between
different replicates. The Z value of each Cres and LHß PCR
reaction, which reflected incorporated radioactivity relative to that of
simultaneously performed PCR reactions, was normalized to the corresponding
GAPDH PCR reaction. This assay does not measure Cres mRNA levels
relative to LHß or GAPDH mRNA levels, but rather compares Cres
mRNA levels between pituitary gland RNA samples analyzed simultaneously by
RT-PCR.
Oligonucleotide Primer Pairs![]()
PCR primers (Invitrogen) were designed from the known sequences for mouse
Cres, LHß, and GAPDH cDNAs using PrimerSelect from Lasergene
Suite (DNA Star, Madison, Wisc) and are as follows: Cres sense:
5' CAAGGAAAGTGAGGACAAATATGTC 3' and antisense: 5'
GTGACAGACTTGAACCACAGGTT 3', Ta (annealing) = 64°C;
LHß sense: 5' AAATGGGGTGGGGTACAGCGAGACG 3' and antisense:
5' TTGGGAAGGAGGGAGGGAGGGATGAT 3'; Ta = 64°C; GAPDH
sense:5' AAGGTCGGAGTCAACGGATT 3' and antisense 5'
TTGATGACAAGCTTCCCGTT 3', Ta = 55°C.
Indirect Immunofluorescence Analysis![]()
Following cardiac puncture, animals were perfused with 4 mL room
temperature PBS followed by 4 mL of cold 4% parafomaldehyde in PBS. Pituitary
glands were removed and further fixed in 4% paraformaldehyde in PBS pH 7.4 for
1 hour at 4°C, then washed successively at 4°C for 30 minutes each in
PBS, 0.9% NaCl, 0.45% NaCl/50% ethanol, and 70% ethanol, and stored in 70%
ethanol overnight. The glands were then dehydrated by incubation in 95%
ethanol for 30 minutes at 4°C followed by 100% ethanol for 30 minutes and
two 1-hour incubations in 100% ethanol at 4°C. Tissues were washed in
xylenes for 40 minutes followed by 1 hour at room temperature and then
embedded in paraffin. Four-micron sections were cut and mounted onto glass
slides by the Texas Tech University Health Sciences Center Electron Microscopy
Center. Sections were deparaffinized by incubating at room temperature twice
(for 10 minutes each) in xylenes, once (for 3 minutes) in 100% ethanol, and
once (for 3 minutes) in 95% ethanol. The slides were air-dried, and the
sections were circled with a Pap pen (Fisher Scientific, Pittsburgh, Pa) to
allow small incubation volumes. After a 20-minute incubation in PBS for
rehydration, the sections were covered with 100% normal goat serum and
incubated in a humidified chamber at 37°C for 90 minutes to block
nonspecific binding sites. The sections were then rinsed with 5 drops 5% goat
serum/PBS and incubated in a humidified chamber at 37°C for 2 hours with a
mixture of guinea pig anti-rat LHß (1:3000) and either rabbit pre-immune,
rabbit anti-mouse CRES antiserum, or rabbit anti-mouse CRES antiserum
preincubated with recombinant CRES protein (1:400 for each). The guinea pig
anti-rat LHß antiserum was developed by A.F. Parlow and was a gift from
the National Hormone and Pituitary Program, National Institute of Diabetes and
Digestive and Kidney Diseases. The specificity of the anti-LHß antiserum
has been demonstrated previously
(Deschepper et al, 1985).
After incubation with primary antibodies, the sections were washed 3x5
minutes at room temperature in PBS and incubated for 1 hour at 37°C in a
dark humidified chamber with a mixture of 1:50 fluorescein isothiocyanate
(FITC)-conjugated goat anti-guinea pig antiserum and 1:50 Texas Red-conjugated
goat anti-rabbit antiserum (both from Jackson ImmunoResearch Laboratories,
Inc, West Grove, Pa). The sections were washed in the dark 3x5 minutes
at room temperature with PBS and 1x5 minutes in PBS, pH = 8.5 and then
inverted onto cover slips with
10 µL mounting medium (92 mM Tris [pH =
8.5], 18.5% dimethylsulfoxide, 23% methanol, 0.092 mg/mL Mowiol 488
[Fisher Scientific]) to which 1 mg/mL p-phenyline diamine (Sigma) was added
immediately before use. After curing overnight in the dark, the sections were
examined using an Olympus Corp BX-60 microscope equipped for epifluorescence
and photographed both with a wide yellow filter for Texas Red and a narrow
band filter for FITC. Multiple sections from 23 individual pituitary
glands from mice in each treatment group of each animal experiment were
examined by immunofluorescence analysis, and representative sections are
shown.
Statistical Analysis![]()
RT-PCR data were statistically evaluated by ANOVA, with differences between
groups determined by Sheffé's S method. The use of ANOVA for analysis
of transformed data was validated using Hartley's test for homogeneity of
population variances. P values of less than .05 were considered
significant. Values are means ± SEM.
| Results |
|---|
|
|
|---|
|
To determine if the administration of steroid hormones would reverse the effects of castration on Cres expression, castrated mice were treated with testosterone (T), estradiol (E2), or dihydrotestosterone (DHT), a nonaromatizable androgen, to eliminate the possibility that aromatization of testosterone to estradiol is involved in the testosterone-mediated negative feedback on gonadotropin levels. For these and subsequent experiments, pituitary glands were pooled from 67 mice in each treatment group to allow for sufficient RT-PCR replicates to minimize experimental variability. Animal experiments were repeated to control for biological variability, and both sets of data are presented. Relative to castrate levels, the combination of castration and hormone maintenance with E2, TP, or DHT further decreased Cres mRNA levels by an average of 60%, 54%, and 42% respectively (Figure 2), suggesting that steroid hormones may negatively regulate Cres mRNA. Alternatively, Cres mRNA could be affected by changes in GnRH as a result of negative feedback from the exogenous steroid hormones.
|
Effect of GnRH Withdrawal and Androgen Treatment on Cres mRNA Levels in Male Pituitary Glands![]()
Because the previous studies did not delineate between steroid hormones and
GnRH as potential regulators of Cres expression, the next set of
experiments was designed to assess the effect of GnRH withdrawal as well as
the direct effect of androgen treatment independent of GnRH on Cres
mRNA levels. Male mice were castrated and treated for 1 week with Antide, a
GnRH antagonist, or Antide + DHT. Antide treatment increased Cres
mRNA approximately 2- to 3-fold above that in castrated animals
(Figure 3). Additional
treatment with DHT resulted in a variable response between the 2 animal
experiments, with a decrease in Cres mRNA relative to castrated +
Antide animals observed in the first experiment and an increase in
Cres mRNA relative to castrated + Antide in the second experiment.
The differential response of Cres mRNA to DHT between the 2 groups of mice may
reflect differences in the efficiency of the DHT replacement. Indeed, this is
indicated by the large difference between the 2 experiments in the serum DHT
levels in the DHT-replaced mice. In the first experiment the mean serum DHT
levels were 2357 pg/mL, while in the second experiment the mean DHT levels
were 113 pg/mL (Figure 3). Thus
those mice exposed to higher levels of circulating DHT exhibited decreased
levels of Cres mRNA. Together, these results suggest that both GnRH
and androgens negatively regulate Cres mRNA in the pituitary gland.
We hypothesized that one possible reason for the modest effects of Antide on
Cres mRNA in castrated mice was that the pituitary glands were
harvested 16 hours after the last Antide injection, when the effects of Antide
could have been waning.
|
In contrast to Cres, Antide treatment dramatically reduced LHß mRNA to an average 9% and 12% of castrate levels in the absence and presence of DHT, respectively (Figure 3).
Effects of Short-Term GnRH Withdrawal on Cres mRNA Levels in Male Pituitary Glands![]()
To further examine the acute effects of GnRH withdrawal on Cres mRNA,
intact animals were given a single injection of vehicle or Antide and
pituitary glands were harvested 4, 12, or 24 hours later.
Figure 4 shows that
Cres mRNA levels were consistently increased approximately 3-fold
following 4 hours of Antide treatment but returned to control levels after 12
hours, demonstrating a negative regulation of Cres mRNA by GnRH and
illustrating the transient nature of the Antide treatment.
|
These studies indicate that the recovery of Cres mRNA to control levels after Antide treatment occurs more rapidly than that of LHß mRNA or serum testosterone, both of which remained considerably reduced at 24 hours. Since even the short-term treatment of mice with Antide disrupted both GnRH and androgens, this experiment also did not rule out androgens as potential regulators of Cres mRNA. However, the return of Cres mRNA to control levels prior to the recovery of serum testosterone argues against androgens mediating the Antide-induced increase in Cres mRNA. Although the in vivo studies together supported GnRH as a negative regulator of Cres mRNA, they did not allow us to make a clear distinction between the effects of steroid hormones and GnRH on Cres mRNA levels. Thus we utilized an in vitro pituitary culture system to measure the direct effects of steroid hormones and GnRH on Cres mRNA levels.
Effects of Steroid Hormones and GnRH on Cres mRNA Levels in Pituitary Gland Organ Cultures![]()
To measure the direct effects of steroid hormones on Cres mRNA,
pituitary glands were cultured in media containing ethanol (vehicle), DHT (10
nM), or E2 (10 nM) for 6 hours. Alternatively, pituitary glands
were exposed to GnRH for 5 minutes every 45 minutes over the 6-hour culture
period in an attempt to mimic endogenous GnRH pulses. The data presented
represent the means of 3 replicate experiments.
Figure 5 shows that, relative
to control pituitary glands cultured in the presence of vehicle alone (control
media [con]), DHT treatment resulted in a minor decrease (25%) in
Cres mRNA while E2 and GnRH treatments significantly
reduced Cres mRNA by 68% and 85%, respectively. These results
confirmed our in vivo studies showing a negative regulation of Cres
mRNA by GnRH and also demonstrated a direct action of E2 on the
pituitary gland to affect Cres mRNA levels. Cres mRNA levels
were also dramatically different between pituitary glands cultured in con and
those taken directly from the animal and not cultured (nc). While it is
difficult to directly compare between in vitro and in vivo models,
Cres mRNA was increased 2-fold in control cultures compared to that
in the animal, which may reflect the loss of negative regulation by GnRH.
|
Effects of Castration and Steroid Replacement on CRES Protein in Anterior Pituitary Gonadotropes![]()
Our previous experiments demonstrated an increase in the intracellular
levels of both CRES and LHß proteins following testosterone treatment in
castrated mice (Sutton et al,
1999). To assess whether this effect is a result of the androgenic
activities of testosterone or its aromatization to E2, pituitary
glands from castrated animals given hormone replacement were examined for CRES
protein by indirect double-label immunofluorescence. As shown in
Figure 6, consistent with our
previous studies, CRES protein levels in gonadotropes were undetectable
following castration, while TP administration increased the amount of
intracellular CRES protein over that present in castrate mice.
Immunofluorescence analyses with the control preimmune serum showed no
staining (data not shown) (Sutton et al,
1999). In contrast to TP administration, E2 treatment
resulted in only low levels of background staining that were also detected
with preimmune serum (data not shown). DHT maintenance, however, dramatically
increased the amount of CRES protein in the gonadotropes to levels similar to,
if not higher, than those of sham operated animals, suggesting that androgens,
rather than estrogens affect CRES protein in gonadotropes.
|
|
Effects of GnRH Withdrawal and Androgen Treatment on CRES Protein in Anterior Pituitary Gonadotropes![]()
We next wanted to determine if the increase we observed in CRES protein
levels following DHT treatment in castrate animals was a direct effect of DHT
upon the pituitary gland or an indirect effect mediated by the hypothalamus
via alterations in GnRH pulses. Thus, we examined CRES protein levels in
pituitary glands from castrated animals treated with or without Antide and
DHT, as described in Figure 3.
CRES protein decreased following 1 week castration
(Figure 7) but appeared
unchanged when castrated animals were treated with Antide. However, DHT, when
given concurrently with Antide, caused a potent increase in intracellular CRES
protein, an effect independent of GnRH. Thus, androgens act directly on the
pituitary gland to affect intracellular levels of CRES protein.
LHß protein levels responded similarly to CRES in that a dramatic decrease in intracellular protein was observed following castration, while the administration of Antide resulted in a very modest increase (Figure 7). The administration of DHT to Antide-treated mice, however, resulted in a profound increase in LHß protein, indicating that, like CRES, androgens directly affect LHß protein in the gonadotrope cells.
| Discussion |
|---|
|
|
|---|
coupled receptor, which activates several signal transduction pathways,
including the IP3 pathway, which mobilizes intracellular Ca++
stores and PKC and several PKC-stimulated MAPK pathways
(Gharib et al, 1990;
Pawson and McNeilly, 2005).
Activation of specific signaling pathways could result in either reduced
Cres transcription or increased Cres mRNA turnover. Indeed,
both transcriptional and posttranscriptional effects of GnRH on gonadotropin
mRNA levels have been described (Chedrese
et al, 1994; Pawson and
McNeilly, 2005). In the hormone replacement study the decrease in Cres mRNA following androgen treatment to castrated mice suggested there might also be a direct effect of androgens on Cres mRNA. However, several lines of evidence suggest that this response may also reflect the influence of GnRH rather than testosterone. Testosterone replacement was expected to lower GnRH and return Cres mRNA to intact levels. However, in both animal experiments the TP-replaced mice had lower serum T (100 ng/dL, 250 ng/dL) and higher serum LH (11, 6.6 ng/mL) than the sham controls (213 ng/dL, 693 ng/dL) (2.8, 5.7 ng/mL), suggesting that GnRH remained elevated, which could account for the persistently reduced levels of Cres mRNA in the TP-replaced mice. In addition, androgen replacement has been shown to prevent the down-regulaton of GnRH receptor that normally occurs in response to castration-induced increases in GnRH pulse frequency (Naik et al, 1984). Thus similar levels of GnRH may produce more pronounced effects, ie, lower Cres mRNA levels in androgen replaced mice relative to castrated mice. Finally, the surprising stimulation of DHT on LHß mRNA suggests that DHT does not reduce GnRH pulse frequency. Consequently, the low levels of Cres mRNA in DHT-replaced mice could reflect increased effects of GnRH resulting from increased GnRH receptor levels. This would be consistent with the increased LHß mRNA in the same mice and agrees with other studies (Lindzey et al, 1998). Lastly, pituitary glands cultured in vitro in the presence of androgens showed only a small decrease in Cres mRNA levels that was not significantly different from control cultures. Taken together, these experiments support GnRH rather than androgens as the primary regulator of Cres mRNA in the male pituitary gland.
Estrogen Negatively Regulates Cres mRNA in the Pituitary Gland![]()
Previous studies have demonstrated that E2 can feed back to the
hypothalamus and/or pituitary gland to suppress the postcastration decrease in
hypothalamic GnRH content as well as the increase in serum gonadotropins
(Gharib et al, 1990;
Lindzey et al, 1998). Thus,
E2-treated castrated mice would be expected to demonstrate an
increase in pituitary Cres mRNA relative to castrate levels resulting
from decreased GnRH input to the pituitary gland. The opposite effect on
Cres mRNA following E2 treatment of castrated mice
suggests that E2 may elicit direct effects on Cres mRNA in
the pituitary gland. Consistent with this, E2 acted directly upon
the pituitary gland in our organ culture studies to significantly reduce,
although not as profoundly as GnRH, Cres mRNA relative to control
cultures. Interestingly, 3 EREs are superimposed over consensus sites for
C/EPB known to be important in Cres transcription
(Hsia and Cornwall, 2001),
suggesting that the inhibitory activity of E2 on Cres mRNA
could be due to interference with C/EPBß binding.
Divergent Expression of Cres and LHß mRNAs![]()
In addition to providing evidence that GnRH, and to a lesser degree
estrogen, negatively regulates Cres mRNA in the male mouse pituitary
gland, our in vivo studies comparing Cres mRNA with LHß mRNA
after various hormonal manipulations also provided clues with regard to CRES
function in the gonadotropes. Specifically, Cres mRNA appeared to be
regulated oppositely to that of LHß mRNA. When serum testosterone levels
were profoundly reduced, as in the castrate state, the expected and observed
response in the pituitary gland was the up-regulation of LHß mRNA and
ultimately increased secretion of LH, a response designed to stimulate
testosterone production from the gonad. These same hormonal conditions
profoundly decreased Cres mRNA levels, suggesting that low levels of
CRES are required during high levels of gonadotrope activity.
Androgens Increase Intracellular Levels of Both CRES and LHß Proteins in the Anterior Pituitary Gland![]()
In contrast to the divergent regulation of Cres and LHß
mRNAs, intracellular CRES and LHß protein levels appear to be regulated
similarly by steroid hormones. This likely is due to the presence of CRES and
LH proteins within the same population of secretory granules, thus allowing
the secretion of both proteins to be regulated similarly. Both CRES and
LHß protein levels were greatly reduced following castration. This was
particularly apparent when we compared the signal intensity and the
size of the gonadotropes, which together provide the most accurate reflection
of the qualitative differences in CRES or LHß proteins, since the
distribution of gonadotropes within a pituitary gland is not homogeneous. The
dramatic effects of TP and DHT and the lack of E2 effects on CRES
and LHß proteins demonstrate that the effects of testosterone on CRES and
LHß are mediated by the androgen receptor rather than by its
aromatization to E2. Furthermore, the increase in protein levels in
animals receiving Antide and DHT demonstrates that the increase is due to the
direct action of androgens on the pituitary gland rather than to indirect
effects mediated by GnRH from the hypothalamus. Androgens have been
demonstrated to reduce LH release from rat gonadotropes by modulating
components of the Ca++ signaling pathway
(Tobin et al, 1997) and by
reducing the synthesis and glycosylation of LH protein
(Muyan and Baldwin, 1992).
However, in this experiment the profound increase in LHß protein observed
with concurrent Antide and DHT treatment is not likely due solely to a
decrease in secretion, since the serum LH levels were similar between Antide
only and Antide + DHT treated groups. In addition, DHT has been shown to
increase serum LH in castrated mice
(Lindzey et al, 1998). This
suggests that DHT may act directly on the pituitary gland to increase
intracellular levels of both CRES and LHß protein, likely via
posttranscriptional mechanisms.
Difference in Cres mRNA and Protein Levels![]()
In several experiments, we observed alterations in Cres mRNA that
did not result in a corresponding change in CRES protein. For example,
castrated animals treated with Antide for 1 week exhibited an increase in
Cres mRNA relative to that in castrated animals, yet a corresponding
increase in intracellular CRES protein was not observed. A similar lack of
change in protein was also noted in animals treated with a single Antide
injection (data not shown). Serum LH did not increase in the Antide-treated
animals, indicating that increased gonadotrope secretory activity was not the
reason for the apparent lack of an increase in intracellular CRES protein.
Together, these studies further support that posttranscriptional mechanisms
may regulate CRES protein levels. Also in support, CRES protein was greatly
increased in castrated mice after DHT treatment despite a decrease in
Cres mRNA. The disparate responses of mRNA and protein in this
experiment could be the result of a posttranscriptional increase in CRES
protein synthesis, a decrease in secretion of CRES following androgen
treatment, or the accumulation of CRES protein due to an increase in its
stability. Finally, these studies cannot exclude the possibility that CRES may
be androgen-regulated at the level of translation, so that androgens cause an
increase in the rate of CRES protein production despite lower mRNA levels.
Functional Significance of CRES in Gonadotropes![]()
The regulation of Cres mRNA and protein at multiple cellular
levels by components of the HPG axis suggests that CRES plays a role in
gonadotrope function. Taken together, the data presented here suggest that
Cres mRNA and protein levels were low at times of peak gonadotrope
secretory activity such as are seen in castrated animals. Conversely,
Cres mRNA levels were generally higher in those groups of intact
animals with higher average serum testosterone, suggesting that increased CRES
levels are favored at times when negative feedback mechanisms maintain lower
overall gonadotrope activity. We propose that in gonadotropes CRES regulates
the activity of a proprotein processing protease whose activity is desirable
at times of high gonadotrope synthetic and secretory activity. Particularly
intriguing is the possibility that CRES inhibits PC2, a prohormone convertase
responsible for processing peptides such as opioids, granins, and PACAP, which
are involved in the local regulation of gonadotropin release via autocrine and
paracrine feedback mechanisms. Since many neuroendocrine peptides are not
sorted and secreted correctly unless they are correctly processed
(Garcia et al, 2005), the
failure of these peptides to mature due to CRES-mediated protease inhibition
would preclude their release from gonadotropes. However, at times of high
secretory activity, such as the castrated state, low CRES protein levels would
allow increased release of regulatory feedback peptides along with the
increased release of LH. In this way, CRES would contribute to the myriad of
subtle influences known to be involved in integrating the diverse functions of
the HPG axis.
| Acknowledgments |
|---|
| Footnotes |
|---|
* Present address: Department of Ob-Gyn, University of Texas Southwestern,
Dallas, Tex. ![]()
| References |
|---|
|
|
|---|
Berman Y, Juliano L, Devi LA. Specificity of the dynorphin-processing endoprotease: comparison with prohormone convertases. J Neurochem. 1999; 72: 2120 2126.[CrossRef][Medline]
Cassina MP, Grantham KD, Neill JD. A temporally intermediate mode of gonadotropin releasing hormone-induced desensitization of luteinizing hormone secretion. Mol Cell Endocrinol. 1997; 132: 53 59.[CrossRef][Medline]
Chedrese PJ, Kay TW, Jameson JL. Gonadotropin-releasing hormone
stimulates glycoprotein hormone alpha-subunit messenger ribonucleic acid
(mRNA) levels in alpha T3 cells by increasing transcription and mRNA
stability. Endocrinology. 1994; 134: 2475
2481.
Coquelin A, Desjardins C. Luteinizing hormone and testosterone secretion in young and old male mice. Am J Physiol. 1982; 243: E257 263.
Cornwall GA, Cameron A, Lindberg I, Hardy DM, Cormier N, Hsia N.
The cystatin-related epididymal spermatogenic protein inhibits the serine
protease prohormone convertase 2. Endocrinology. 2003; 144: 901
908.
Cornwall GA, Hann SR. Transient appearance of CRES protein during spermatogenesis and caput epididymal sperm maturation. Mol Reprod Dev. 1995;41: 37 46.[CrossRef][Medline]
Cornwall GA, Hsia N. A new subgroup of the family 2 cystatins. Mol Cell Endocrinol. 2003; 200: 1 8.[CrossRef][Medline]
Cornwall GA, Orgebin-Crist MC, Hann SR. The CRES gene: a unique
testis-regulated gene related to the cystatin family is highly restricted in
its expression to the proximal region of the mouse epididymis. Mol
Endocrinol. 1992;6: 1653
1664.
Counis R, Laverriere JN, Garrel G, Bleux C, Cohen-Tannoudji J, Lerrant Y, Kottler ML, Magre S. Gonadotropin-releasing hormone and the control of gonadotrope function. Reprod Nutr Dev. 2005; 45: 243 254.[CrossRef][Medline]
Deschepper CF, Seidler CD, Steele MK, Ganong WF. Further studies on the localization of angiotensin-II-like immunoreactivity in the anterior pituitary gland of the male rat, comparing various antisera to pituitary hormones and their specificity. Neuroendocrinology. 1985; 40: 471 475.[Medline]
Dong W, Day R. Gene expression of proprotein convertases in
individual rat anterior pituitary cells and their regulation in corticotrophs
mediated by glucocorticoids. Endocrinology. 2002; 143: 254
262.
Dragatsis I, Papazafiri P, Zioudrou C, Gerozissis K. Opioids modify
the release of LH at the pituitary level: in vitro studies with entire rat
pituitaries. J Endocrinol. 1995; 145: 263
270.
Fallest PC, Trader GL, Darrow JM, Shupnik MA. Regulation of rat luteinizing hormone beta gene expression in transgenic mice by steroids and a gonadotropin-releasing hormone antagonist. Biol Reprod. 1995;53: 103 109.[Abstract]
Garcia AL, Han SK, Janssen WG, Khaing ZZ, Ito T, Glucksman MJ,
Benson DL, Salton SR. A prohormone convertase cleavage site within a predicted
alpha-helix mediates sorting of the neuronal and endocrine polypeptide VGF
into the regulated secretory pathway. J Biol Chem. 2005; 280: 41595
41608.
Gharib SD, Wierman ME, Shupnik MA, Chin WW. Molecular biology of
the pituitary gonadotropins. Endocr Rev. 1990; 11: 177
199.
Hsia N, Cornwall GA. CCAAT/enhancer binding protein beta regulates
expression of the cystatin-related epididymal spermatogenic (Cres) gene.
Biol Reprod. 2001; 65: 1452
1461.
Hsia N, Cornwall GA. Cres2 and Cres3: new members of the
cystatin-related epididymal spermatogenic subgroup of family 2 cystatins.
Endocrinology. 2003; 144: 909
915.
Huang Z, Fasco MJ, Kaminsky LS. Optimization of Dnase I removal of contaminating DNA from RNA for use in quantitative RNA-PCR. Biotechniques. 1996; 20: 1012 1014, 1016, 10181020.[Medline]
Jutras I, Seidah NG, Reudelhuber TL, Brechler V. Two activation
states of the prohormone convertase PC1 in the secretory pathway. J
Biol Chem. 1997;272: 15184
15188.
Koves K, Kantor O, Scammell JG, Arimura A. PACAP colocalizes with luteinizing and follicle-stimulating hormone immunoreactivities in the anterior lobe of the pituitary gland. Peptides. 1998; 19: 1069 1072.[CrossRef][Medline]
Laslop A, Weiss C, Savaria D, Eiter C, Tooze SA, Seidah NG, Winkler H. Proteolytic processing of chromogranin B and secretogranin II by prohormone convertases. J Neurochem. 1998; 70: 374 383.[Medline]
Lindzey J, Wetsel WC, Couse JF, Stoker T, Cooper R, Korach KS.
Effects of castration and chronic steroid treatments on hypothalamic
gonadotropin-releasing hormone content and pituitary gonadotropins in male
wild-type and estrogen receptor-alpha knockout mice.
Endocrinology. 1998; 139: 4092
4101.
Muyan M, Baldwin DM. Testosterone suppresses 8-bromo-adenosine
3',5'-monophosphate and gonadotropin-releasing hormone-stimulated
luteinizing hormone subunit synthesis. Endocrinology. 1992; 130: 3337
3344.
Muyan M, Roser JF, Dybdal N, Baldwin DM. Modulation of gonadotropin-releasing hormone-stimulated luteinizing hormone release in cultured male equine anterior pituitary cells by gonadal steroids. Biol Reprod. 1993; 49: 340 345.[Abstract]
Naik SI, Young LS, Charlton HM, Clayton RN. Pituitary
gonadotropin-releasing hormone receptor regulation in mice. I:Males.
Endocrinology. 1984; 115: 106
113.
Pawson AJ, McNeilly AS. The pituitary effects of GnRH. Animal Reprod Sci. 2005; 88: 75 94.
Ravindra R, Aronstam RS. Progesterone, testosterone and
estradiol-17 beta inhibit gonadotropin-releasing hormone stimulation of G
protein GTPase activity in plasma membranes from rat anterior pituitary lobe.
Acta Endocrinol (Copenh). 1992; 126: 345
349.
Shupnik MA. Effects of gonadotropin-releasing hormone on rat
gonadotropin gene transcription in vitro: requirement for pulsatile
administration for luteinizing hormone-beta gene stimulation. Mol
Endocrinol. 1990;4: 1444
1450.
Shupnik MA. Gonadotropin gene modulation by steroids and gonadotropin-releasing hormone. Biol Reprod. 1996; 54: 279 286.[Abstract]
Sion B, Chanat E, Duval J, Thieulant ML. Peptides co-released with luteinizing hormone by perifused pituitary cell aggregates. Mol Cell Endocrinol. 1988;60: 151 161.[CrossRef][Medline]
Sutton HG, Fusco A, Cornwall GA. Cystatin-related epididymal
spermatogenic protein colocalizes with luteinizing hormone-beta protein in
mouse anterior pituitary gonadotropes. Endocrinology. 1999; 140: 2721
2732.
Tobin VA, Millar RP, Canny BJ. Testosterone acts directly at the
pituitary to regulate gonadotropin-releasing hormone-induced calcium signals
in male rat gonadotropes. Endocrinology. 1997; 138: 3314
3319.
Tsujii T, Winters SJ. Effects of pulsatile pituitary adenylate cyclase activating polypeptide (PACAP) on gonadotropin secretion and subunit mRNA levels in perifused rat pituitary cells. Life Sci. 1995;56: 1103 1111.[CrossRef][Medline]
Weiss J, Jameson JL, Burrin JM, Crowley WF Jr. Divergent responses
of gonadotropin subunit messenger RNAs to continuous versus pulsatile
gonadotropin-releasing hormone in vitro. Mol
Endocrinol. 1990;4: 557
564.
Westphal CH, Muller L, Zhou A, Zhu X, Bonner-Weir S, Schambelan M, Steiner DF, Lindberg I, Leder P. The neuroendocrine protein 7B2 is required for peptide hormone processing in vivo and provides a novel mechanism for pituitary Cushing's disease. Cell. 1999; 96: 689 700.[CrossRef][Medline]
Winters SJ, Ishizaka K, Kitahara S, Troen P, Attardi B. Effects of
testosterone on gonadotropin subunit messenger ribonucleic acids in the
presence or absence of gonadotropin-releasing hormone.
Endocrinology. 1992; 130: 726
734.
This article has been cited by other articles:
![]() |
R. Mancinelli, P. Onori, E. Gaudio, S. DeMorrow, A. Franchitto, H. Francis, S. Glaser, G. Carpino, J. Venter, D. Alvaro, et al. Follicle-stimulating hormone increases cholangiocyte proliferation by an autocrine mechanism via cAMP-dependent phosphorylation of ERK1/2 and Elk-1 Am J Physiol Gastrointest Liver Physiol, July 1, 2009; 297(1): G11 - G26. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |