| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


From the * Centre for Cellular and Molecular
Biology, Uppal Road, Hyderabad, India; and the
Institute of Reproductive Medicine, Salt Lake,
Kolkata, India.
| Correspondence to: Dr. K. Thangaraj, Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500 007, India (e-mail: thangs{at}ccmb.res.in). |
| Received for publication April 6, 2006; accepted for publication June 21, 2006. |
| Abstract |
|---|
|
|
|---|
Key words: Androgen receptor, GGN repeat, male infertility, semen abnormality
The AR gene has been mapped to the long arm (Xq11-12) of the X-chromosome (Lubahn et al, 1988b; Yong et al, 1998). The gene consists of 8 exons and encodes a protein of 919 amino acids with 3 major functional domains: the N-terminal domain (NTD or transactivation domain), the DNA-binding domain (DBD), and the ligand-binding domain (LBD). The AR protein is a member of the nuclear receptor superfamily of ligand-activated transcription factors. Exon 1 of the gene consists of 2 polymorphic repeat (CAG and GGN) motifs, encoding variable lengths of polyglutamine and polyglycine stretches, respectively, in the N-terminal region (transactivation domain) of the AR protein (Lubahn et al, 1988a; Faber et al, 1989). CAG, a simple repeat, varies in length from 8 to 35 repeats, while GGN, a complex repeat represented by (GGT)3GGG(GGT)2(GGC)n, varies in length from 10 to 30 repeats.
The CAG repeat has been well studied in a variety of medical conditions in addition to male infertility (Hickey et al, 2002; Sasaki et al, 2003; Yong et al, 2003). Expansion of the CAG repeat above the normal range has been found to be associated with adult onset of spinal and bulbar muscular atrophy (La Spada et al, 1991), characterized by undermasculinization and progressive neuromuscular degeneration. Expanded CAG repeat number within the normal range has also been found to be associated with male infertility in some populations, but this is not true for all populations (Yong et al, 2003). Decreased CAG repeats, on the other hand, have been found to be associated with prostate cancer (Giovannucci et al, 1997; Mishra et al, 2005). The inverse correlation between CAG repeats length and AR transactivation potential has been demonstrated in vitro (Chamberlain, 1994, Kazemi-Esfarjani et al, 1995). We have earlier analyzed the CAG repeat polymorphism in 280 azoospermic and 201 fertile Indian men and found no correlation between the repeat length variation and infertility (Thangaraj et al, 2002).
Although deletion of the GGN repeat resulted in a 30% reduction in AR transcriptional activation in transfection assays (Gao et al, 1996), the GGN repeat has been less studied, mainly due to technical problems in the amplification resulting from the high GC content of this repeat. To our knowledge, only 4 studies on the GGN repeat in male infertility have been conducted to date (Tut et al, 1997; Lundin et al, 2003; Ferlin et al, 2004; Ruhayel et al, 2004). Hence the functional implications of variation in the GGN repeat are unclear. In particular, no study has been conducted on the role of the GGN repeat in male infertility among Indian men. Further, although normal variation of the CAG repeat has been well studied in many populations and worldwide polymorphism data exists, much less is known about the polymorphic variation of the GGN repeat, and nothing at all for Indian populations. Therefore, we have now analyzed the GGN repeat length in 395 infertile and 200 normozoospermic Indian men to understand the correlation between polymorphisms in this repeat and male infertility and to document the normal polymorphism of this repeat in Indian populations.
| Materials and Methods |
|---|
|
|
|---|
Genetic Analysis![]()
DNA was extracted from peripheral blood by the method described in our
earlier study (Thangaraj et al,
2002). The AR-GGN repeat was amplified with the primers:
forward 5'FAM-CCGCTTCCTCATCCTGGCACAC 3' and reverse 5'
GCCGCCAGGGTACCACACATC 3', flanking the repeat. PCR primers were designed
using GeneTool software and synthesized using a 394 DNA/RNA oligosynthesizer
(Applied Biosystems, Foster City, Calif). PCR reactions were set in a 10 µL
volume with the composition 1.0 µL PCR buffer (10x), 1.0 µL
MgCl2 (25 mM), 1.0 µL dNTPs (10 mM), 5 pM of each primer, 0.5
units AmpliTaq Gold DNA polymerase, 0.4 µL DMSO (100%), 0.6 µL glycerol
(100%), and 20 ng DNA. PCR reactions were performed under the following
conditions: initial denaturation at 96°C for 12 minutes, followed by 40
cycles of 96°C for 1.5 minutes, 60°C for 1 minute, and 72°C for 3
minutes, with a final extension for 20 minutes at 72°C. The lengths of the
PCR products were assessed by GeneScan analysis. For GeneScan, 3.0 µL of
the PCR product was mixed with 0.2 µL of LIZ500 and 6.8 µL of formamide.
After denaturation for 5 minutes at 95°C and cooling on ice for 5 minutes,
the samples were run on a 3730 DNA analyzer (Applied Biosystems). The raw data
were further analyzed using GeneMapper software to calculate the number of
repeats. PCR and GeneScan were repeated for all the samples to confirm the
number of repeats.
Statistical Analysis![]()
The mean, median, and mode of the repeat number were calculated for all the
sample categories using SPSS software (version 10; SPSS, Inc, Chicago, Ill).
In addition to the analysis of all the patients as 1 group, and the controls
as 1 group, we also analyzed the repeat length in various subgroups of the
patients. The significance of the difference in the mean repeat length was
compared for different subgroups of the samples against controls using an
independent-samples t test. Two-sided P values of less than
.05 were considered significant. In addition, the frequency distribution of
the repeats was also calculated for all the 595 samples irrespective of their
fertility status to illustrate the general distribution of the repeat in
Indian populations.
|
| Results |
|---|
|
|
|---|
| Discussion |
|---|
|
|
|---|
20% of infertility cases (Thangaraj et al,
unpublished data). Thus the majority of infertile cases remain unexplained.
Mutations in the AR gene, including variation in the number of CAG
repeats, have been found to be associated with male infertility in some
populations but not others (Yong et al,
2003). AR-GGN repeat length polymorphism has been less studied in
male infertility. Among the Indian populations, no earlier study has been
conducted on GGN repeat length polymorphisms in male infertility. In the present study, we have analyzed the AR-GGN repeat length polymorphism in a total of 595 men from India, and found it to be less polymorphic than the CAG repeat (Table). AR alleles with 21 and 22 GGN repeats predominate in Indian populations (Figure). An earlier study of an Italian population found AR alleles with 23 and 24 GGN repeats (17 and 18 GGC repeats) to be the commonest (Ferlin et al, 2004), which may reflect a geographical difference between the populations.
Furthermore, we found no association of the GGN repeat number with spermatogenic status. Indeed, unlike the varying correlation of the CAG repeat with male infertility, all studies on the GGN repeat thus far have shown no association with male infertility (Tut et al, 1997; Lundin et al, 2003; Ferlin et al, 2004; Ruhayel et al, 2004). However, studies on the GGN repeat in other diseases, especially prostate cancer, have given a more confusing picture: no association was detected in Scottish men (Tayeb et al, 2004), but a 12% increased risk was found in Chinese men with a repeat length less than 23 (Hsing et al, 2000) and an increased risk associated with shorter GGN repeats in other populations (Hakimi et al, 1997; Stanford et al, 1997), while, in contrast, an increased risk was associated with longer GGN repeats in yet another study (Edwards et al, 1999). The overall picture is thus still not clear, and further well-planned epidemiological studies are required to elucidate the role of the GGN repeat in AR function.
The AR gene has been shown to play role in final stages of sperm
differentiation, and hence defects in the AR gene are more likely to
cause reduced sperm counts along with sperm deformities (oligozoospermia or
oligoteratozoospermia) rather than complete absence of the sperms
(azoospermia) (Singh et al,
2006). Out of 395 infertile cases analyzed in the present study,
277 cases were azoospermic, and hence the results could be biased not to give
a fair idea about the correlation of the repeat length polymorphisms with
oligozoospermia or oligoteratozoospermia. Therefore, we analyzed GGN repeat
length for each subgroup of the cases versus controls. This revealed no
association of repeat polymorphism with azoospermia, oligozoospermia, or
oligoteratozoospermia (Figure). No difference was observed even between
azoospermic and all oligozoospermic cases (oligozoospermic and
oligoteratozoospermic). However, in the oligozoospermic cases AR
alleles with 16, 17, 20, 23, 24, and 25 GGN repeats, and in
oligoteratozoospermic cases the alleles with 15, 16, 17, 18, 20, 23, 24, and
25 GGN repeats, were not observed (Figure). These are the alleles with very
low frequencies in the population; therefore the differences could be
attributed to the lesser number of the oligozoospermic and even lesser number
of oligoteratozoospermic cases in comparison to azoospermic or normozoospermic
cases.
|
In all the cases included in this study, we have previously sequenced the whole AR gene and found no mutations (Singh et al, 2006). The present study, along with the previous one, thus demonstrates that the AR gene does not contribute significantly to male infertility in Indian populations. This conclusion contrasts with the observed decrease in the AR transcriptional activation upon deletion of GGN repeats in transfection assays (Gao et al, 1996), but it needs to be ascertained if the decrease in the number of GGN repeats parallels the decrease in the transactivation. However, it needs to be mentioned that the absence of correlation of the GGN repeat length with male infertility in the present study does not reflect absence of correlation between the repeat length and AR function. It has been found that longer CAG repeat resulted in decreased ability of AR to be coactivated by its coregulators (Heinlein et al, 2004), and it needs to be established if the GGN repeat affects the interaction of AR with its coregulators. Along with this, polymorphisms in other AR interacting genes, such as steroid receptor coregulator-1 (SRC-1) and transcriptional intermediary factor 2 (TIF-2), may also affect AR functions, spermatogenesis, and hence male fertility. In addition, the heavy use of agricultural and industrial chemicals, many of which have been proven to be endocrine disruptors, might contribute to the disruption of the androgenic functions, leading to decreased sperm counts or infertility. Thus the absence of a simple relationship between AR-GGN repeat length, likely transcriptional activation, and sperm count in India is readily explained.
In conclusion, AR-GGN repeat length polymorphism showed no correlation with male infertility in our study. Nevertheless, 80% of male infertility in India remains unexplained, and investigation of further genetic and nongenetic factors that may influence spermatogenic status is required. Although it seems from most of the studies that GGN repeat length doesn't affect the AR functions significantly, it would be premature to draw conclusions about the role of GGN repeat at this stage. This is the first study addressing analysis of GGN repeat in male infertility in Indian populations and the fifth such study worldwide. More studies on GGN repeat, along with in vitro assays using AR alleles with different number of GGN repeats, will add to the wealth of knowledge about the role of GGN repeat in AR function and its correlation with male infertility.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Edwards SM, Badzioch MD, Minter R, Hamoudi R, Collins N, Ardern-Jones A, Dowe A, Osborne S, Kelly J, Shearer R, Easton DF, Saunders GF, Dearnaley DP, Eeles RA. Androgen receptor polymorphisms: association with prostate cancer risk, relapse and overall survival. Int J Cancer. 1999;84: 458 465.[CrossRef][Medline]
Faber PW, Kuiper GGJM, van Rooij HCJ, van der Korput J, Brinkmann AO, Trapman J. The N-terminal domain of the human androgen receptor is encoded by one, large exon. Mol Cell Endocrinol. 1989; 61: 257 262.[CrossRef][Medline]
Ferlin A, Bartoloni L, Rizzo G, Roverato A, Garolla A, Foresta C.
Androgen receptor gene CAG and GGC repeat lengths in idiopathic male
infertility. Mol Hum Reprod. 2004; 10: 417
421.
Gao T, Marcelli M, McPhaul MJ. Transcriptional activation and transient expression of the human androgen receptor. J Steroid Biochem Mol Biol. 1996;59: 9 20.[CrossRef][Medline]
Giovannucci E, Stampfer MJ, Krithivas K, Brown M, Dahl D, Brufsky
A, Talcott J, Hennekens CH, Kantoff PW. The CAG repeat within the androgen
receptor gene and its relationship to prostate cancer. Proc Natl
Acad Sci U S A. 1997;94: 3320
3323.
Hakimi JM, Schoenberg MP, Rondinelli RH, Piantadosi S, Barrack ER. Androgen receptor variants with short glutamine or glycine repeats may identify unique subpopulations of men with prostate cancer. Clin Cancer Res. 1997;3: 1599 1608.[Abstract]
Heinlein CA, Chang C. Androgen receptor in prostate cancer.
Endocr Rev. 2004; 25: 276
308.
Hickey T, Chandy A, Norman RJ. The androgen receptor CAG repeat
polymorphism and X-chromosome inactivation in Australian Caucasian women with
infertility related to polycystic ovary syndrome. J Clin Endocrinol
Metab. 2002;87: 161
165.
Hsing AW, Gao YT, Wu G, Wang X, Deng J, Chen YL, Sesterhenn IA,
Mostofi FK, Benichou J, Chang C. Polymorphic CAG and GGN repeat lengths in the
androgen receptor gene and prostate cancer risk: a population-based
case-control study in China. Cancer Res. 2000; 60: 5111
5116.
Kazemi-Esfarjani P, Trifiro MA, Pinsky L. Evidence for a repressive
function of the long polyglutamine tract in the human androgen receptor:
possible pathogenetic relevance for the (CAG)n-expanded neuronopathies.
Hum Mol Genet. 1995; 4: 523
527.
La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature. 1991; 352: 77 79.[CrossRef][Medline]
Lubahn DB, Joseph DR, Sar M, Tan J, Higgs HN, Larson RE, French FS,
Wilson EM. The human androgen receptor: complementary deoxyribonucleic acid
cloning, sequence analysis and gene expression in prostate. Mol
Endocrinol. 1988a;2: 1265
1275.
Lubahn DB, Joseph DR, Sullivan PM, Willard HF, French FS, Wilson
EM. Cloning of human androgen receptor complementary DNA and localization to
the X chromosome. Science. 1988b; 240: 327
330.
Lundin KB, Giwercman A, Richthoff J, Abrahamsson PA, Giwercman YL.
No association between mutations in the human androgen receptor GGN repeat and
inter-sex conditions. Mol Hum Reprod. 2003; 9: 375
379.
Mishra D, Thangaraj K, Mandhani A, Kumar A, Mittal R. Is reduced CAG repeat length in androgen receptor gene associated with risk of prostate cancer in Indian population? Clin Genet. 2005; 68: 55 60.[Medline]
Ruhayel Y, Lundin K, Giwercman Y, Hallden C, Willen M, Giwercman A.
Androgen receptor gene GGN and CAG polymorphisms among severely
oligozoospermic and azoospermic Swedish men. Hum
Reprod. 2004;19: 2076
2083.
Sasaki M, Sakuragi N, Dahiya R. The CAG repeats in exon 1 of the androgen receptor gene are significantly longer in endometrial cancer patients. Biochem Biophys Res Commun. 2003; 305: 1105 1108.[CrossRef][Medline]
Singh R, Deepa SR, Madhavi S, Gupta NJ, Chakravarty B, Singh L,
Thangaraj K. Male infertility: no evidence of involvement of androgen receptor
gene among Indian men. J Androl. 2006; 27: 102
105.
Stanford JL, Just JJ, Gibbs M, Wicklund KG, Neal CL, Blumenstein
BA, Ostrander EA. Polymorphic repeats in the androgen receptor gene: molecular
markers of prostate cancer risk. Cancer Res. 1997; 57: 1194
1198.
Tayeb MT, Clark C, Murray GI, Sharp L, Haites NE, McLeod HL. Length and somatic mosaicism of CAG and GGN repeats in the androgen receptor gene and the risk of prostate cancer in men with benign prostatic hyperplasia. Ann Saudi Med. 2004; 24: 21 26.[Medline]
Tesarik J, Guido M, Mendoza C, Greco E. Human spermatogenesis in
vitro: respective effects of follicle-stimulating hormone and testosterone on
meiosis, spermiogenesis, and Sertoli cell apoptosis. J Clin
Endocrinol Metab. 1998;83: 4467
4473.
Thangaraj K, Gupta NJ, Pavani K, Reddy AG, Subramainan S, Rani DS,
Ghosh B, Chakravarty B, Singh L. Y chromosome deletions in azoospermic men in
India. J Androl. 2003; 24: 588
597.
Thangaraj K, Joshi MB, Reddy AG, Gupta NJ, Chakravarty B, Singh L.
CAG repeat expansion in the androgen receptor gene is not associated with male
infertility in Indian populations. J Androl. 2002; 23: 815
818.
Tut TG, Ghadessy FJ, Trifiro MA, Pinsky L, Yong EL. Long
polyglutamine tracts in the androgen receptor are associated with reduced
trans-activation, impaired sperm production, and male infertility.
J Clin Endocrinol Metab. 1997; 82: 3777
3782.
Yong EL, Ghadessy F, Wang Q, Mifsud A, Ng SC. Androgen receptor transactivation domain and control of spermatogenesis. Rev Reprod. 1998;3: 141 144.[Abstract]
Yong EL, Loy CJ, Sim KS. Androgen receptor gene and male
infertility. Hum Reprod Update. 2003; 9: 1
7.
This article has been cited by other articles:
![]() |
S. T. Page, J. K. Amory, and W. J. Bremner Advances in Male Contraception Endocr. Rev., June 1, 2008; 29(4): 465 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Davis-Dao, E. D. Tuazon, R. Z. Sokol, and V. K. Cortessis Male Infertility and Variation in CAG Repeat Length in the Androgen Receptor Gene: A Meta-analysis J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4319 - 4326. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Marietta Clewing, B. C Antalfy, T. Lucke, B. Najafian, K. M Marwedel, A. Hori, R. M Powel, A F Safo Do, L. Najera, K. SantaCruz, et al. Schimke immuno-osseous dysplasia: a clinicopathological correlation J. Med. Genet., February 1, 2007; 44(2): 122 - 130. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |