| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Biochemistry Laboratory, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi, India.
| Correspondence to: Prof Kasturi Datta, Biochemistry Laboratory, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi-110067, India (e-mail: kdatta{at}mail.jnu.ac.in). |
| Received for publication October 18, 2005; accepted for publication March 12, 2006. |
| Abstract |
|---|
|
|
|---|
Key words: Pachytene spermatids, round spermatids, developing rat testis, spermatogenic arrest
| Introduction |
|---|
|
|
|---|
HABP1 is synthesized as a proprotein of 282 amino acids, which, after translation, is processed by proteolytic cleavage of initial 73 amino acids to a mature form of 209 amino acids. This proprotein form of HABP1 is extremely labile and has only been detected in pachytene spermatocytes and round spermatids in the germ cells in testes of adult rats (Bharadwaj et al, 2002). During spermatogenesis in rats, different subpopulations of germ cells are acquired, depending on the developmental stage. We report results of study to determine the expression of HABP1 proprotein in different cell types in the testes of developing rats. Additionally, to understand the role of the proprotein form of HABP1 in spermatogenic differentiation, we evaluated testes from rats in which spermatogenic arrest was induced.
| Materials and Methods |
|---|
|
|
|---|
Purification of HABP1 and Generation of Antibodies![]()
HABP1 was purified to homogeneity with an ion exchange column coupled to a
Pharmacia FPLC system, as reported elsewhere
(Jha et al, 2002). Polyclonal
anti-rHABPl antibodies were raised against the purified recombinant HABP1
(rHABPl) in rabbit, as previously described
(Deb and Datta, 1996).
Arrest of Spermatogenesis![]()
Adult male rats weighing 250300 g received intramuscular injections
of 75 µg of ß-estradiol-17-benzoate suspended in 0.25 mL of olive oil
(vehicle) daily for 30 days, as reported earlier
(Chinmoy et al, 1984). The
spermatogenic status was examined microscopically after hematoxylin-eosin
staining of testis sections.
After ß-estradiol-17-benzoate treatment, the seminiferous tubules showed an arrest in the development of spermatozoa, as revealed by a complete absence of elongated spermatids (or testicular spermatozoa). However, Sertoli cells, spermatogonia, spermatocytes, and a few round spermatids were seen.
Tissues and Lysate Preparation![]()
Testes from rats aged 7, 14, 21, and 28 days and from adult rats were
collected from approximately 10 Sprague Dawley rats per age group (Animal
House, Jawaharlal Nehru University, New Delhi, India). The animals were killed
in accordance with the protocol approved by the animal ethics committee at
Jawaharlal Nehru University. For sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) and Western blotting, the testes lysate was
prepared by removing tunica albuginea, followed by immediate boiling of the
seminiferous tubules in Laemmli buffer (Tris-glycerol with 5%
ß-mercaptoethanol, 2% SDS, and 100 mmol/L PMSF [phenyl methyl sulfonyl
fluride]) for 15 minutes (Laemmli,
1970). Subsequently, the lysate was centrifuged at 14 000 x
g for 15 minutes at room temperature, and the supernatant containing
the total lysate protein was stored at 20°C until use. The protein
concentration was estimated using the bicinchoninic acid protein assay system
with bovine serum albumin (BSA) as a standard
(Smith et al, 1985).
SDS-PAGE and Western Blot Analysis![]()
Testicular lysate protein (70 µg) was resolved on a 12.5% PAGE under
denaturing conditions (Laemmli,
1970). Resolved proteins were electroblotted onto a nitrocellulose
membrane and were probed with polyclonal anti-rHABP1 antibody (titer, 1:2500).
After incubation with goat anti-rabbit IgG conjugated to alkaline phosphatase
(AP), the immunoreactive bands were detected with the nitroblue
tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) system (USB
Corporation, Cleveland, Ohio).
Immunohistochemistry![]()
For immunohistochemical study, the organs fixed by immersion in Bouin's
fixative were dehydrated through graded alcohol and xylene and were embedded
in paraffin wax. The sections of rat testis (5-µm thick) were
deparaffinized, rehydrated, and blocked with 3% wt/vol BSA in Tris-buffered
saline (TBS, 0.05 mol/L Tris-Cl, pH 7.6; 0.15 mol/L NaCl). After specimens
were washed with 0.05% Tween 20supplemented TBS (TBST), they were
incubated with polyclonal anti-rHABPl antibody (titer, 1:200). After
incubation with goat anti-rabbit IgG conjugated to AP (titer, 1:500), Fast Red
substrate (DAKO, A/S, Glostrup, Denmark) was used to develop color, in
accordance with the manufacturer's protocol. The counterstaining was done
using hematoxylin, and sections were mounted in glycerol.
RNA Isolation and Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR) Analysis![]()
Total RNA was isolated from the testes of developing rats by use of TRIZOL
reagent (Invitrogen, Life Technologies, Carlsbad, Calif), according to the
manufacturer's protocol (Chomezynski and Sacchi, 1987). Single step RT-PCR was
performed on 2 µg of total RNA from different tissues with the rTth enzyme
(PE Applied Biosystems, Branchburg, NJ). We used the RAB3 forward HABP1 primer
5'-CCGGCCCTTCGGTTTGCTCAGCGT-3' and the RAB4 reverse HABP1 primer
5' GGCCCAGTCCAGGGAGTCTGTGTT 3', which designed on the basis of the
exons of the gene encoding HABP1. The amplification was performed for 25
cycles to ensure linear amplification. ß-Actin amplification was
performed to obtain an internal control, using the same reaction mixture.
RT-PCR for ß-actin was done using the following primers: forward primer,
5'-CGTGCGCCGCCCTAGGCACCA-3'; and reverse primer,
5'-TTGGCCTTAGGGTTCAGGGGGG-3'.
| Results |
|---|
|
|
|---|
|
To study the differential expression of the proprotein form of HABP1 in different cell types during testis development, testis sections from developing rats (7, 14, 21, and 28 days old) and adult rats were immunostained with anti-rHABP1 antibody. Testes from the 7-day-old rats, which contained only gonocytes and spermatogonia (Figure 2A), and testes from the 14-day-old rats, which had spermatogonia and leptotene spermatocytes, did not show any expression of the proprotein form of HABP1 (Figure 2C).
|
By day 28, haploid round spermatids were detected in testes of the developing rats, and the proprotein form were observed in these cells in testes from the 28-day-old rats (Figure 2G). Intense cytoplasmic staining was also seen in the cytoplasm of pachytene spermatocytes. However, no staining was detected in the spermatogonia and the leptotene and zygotene spermatocytes.
As expected, in testes from adult rats (where all germ cells are present), cytoplasmic staining was seen in the pachytene spermatocytes and round spermatids, but no staining was detected in the spermatogonia, early spermatocytes, and elongated spermatids (Figure 2I). It is evident from the data that, when the germ cells in developing testes differentiate into either pachytene spermatocytes or round spermatids, HABP1 proprotein expression occurs. Thus, expression was detected in the testis only after day 20 and continued until adulthood, which suggests that the proprotein form of HABP1 plays a role during spermatogenesis.
HABPl mRNA Expression in Developing Rat Testis![]()
To determine the relative level of HABP1 transcript in testes of developing
and adult rats, total RNA isolated from testes from rats in each age groups
were analyzed by RT-PCR under semiquantitative conditions. A 583-bp
amplification product was obtained from RNA samples of all testes, using RAB3
and RAB4 primers of the gene encoding HABP1
(Figure 3A). Control RT-PCR was
performed with ß-actin primers. Comparable amounts of amplified
ß-actin transcripts obtained from equal quantities of RNA from 5
different testes confirmed the integrity and the quantitative nature of the
RT-PCR reaction (Figure 3B).
The same level of HABP1 transcript was also detected in the testes from rats
aged 7, 14, and 21 days. In testes from rats aged 28 days, the level of
transcript was higher than that in testes from the other developing rats. The
most significant increase in RNA transcripts was observed in adult rats. This
observation was consistent across at least 10 independent experiments. Higher
levels of HABP1 mRNA transcript in testes from rats aged 28 days and from
adult rats implies a higher expression of the gene encoding HABP1 in these age
groups (Figure 3C). This
observation correlates well with the fact that rats in these age groups
contain higher number of pachytene spermatocytes and round spermatids, which
also demonstrates higher expression of the translated product.
|
|
Immunohistochemical analysis was performed to determine the expression of HABP1 proprotein in spermatogenic-arrested testis. Complete arrest of spermatogenesis in sections of rat testes from treated adult rats was indicated by the absence of sperm in the seminiferous tubules (data not shown). A significant reduction in HABP1 proprotein expression was seen in pachytene spermatocytes from the spermatogenic-arrested testicular tubules, compared with that in testes from healthy, untreated rats. Even the round spermatids that were present in few numbers were devoid of HABP1 proprotein (Figure 5A and B). In contrast, immunostaining of testes from untreated adult rats showed the usual intense staining in the pachytene spermatocytes and round spermatids (Figure 5D and E).
|
| Discussion |
|---|
|
|
|---|
During spermatogenesis, certain testis-specific genes and testis-specific variants of somatic genes are differentially expressed (Wolgermuth and Watrin, 1991; Penttila et al, 1995). Similar the expression of other cell-specific genes, HABP1 proprotein expression solely in pachytene spermatocytes and round spermatids suggests that it plays a role in these cells types during spermatogenesis.
Immunohistochemical analysis of testes from rats aged 7 and 14 days showed the absence of the proprotein form of HABP1 in all cell types, whereas after the onset of pachytene spermatocyte formation in rats aged 21 days and round spermatid formation in rats aged 28 days, the proprotein form could be detected by the antibody against HABP1. Because the proprotein form is present only in a small number of cells in testes from rats aged 21 and 28 days, it could not be detected by immunoblot analysis of the total testicular extract. However, because the adult testis contains more pachytene spermatocytes and round spermatids (as evident from the immunohistochemical analysis), the proprotein form could be detected by immunoblotting.
The level of expression of HABP1 transcripts in adults rats was also significantly higher than that in rats aged 7 days. In testes from adult rats, where continuous meiosis takes place, the HABP1 mRNA expression increased several fold, and this finding correlates well with HABP1 proprotein accumulation. The higher level of HABP1 transcripts might be due to transcriptional upregulation or to mRNA storage and delayed post-translational cleavage in meiotic and postmeiotic cells. mRNA storage is common in pachytene spermatocytes, where the mRNA is saved for use during spermatogenesis (Soderstrom, 1976). Therefore, the accumulation of HABP1 proprotein and the storage of mRNA transcripts may imply that the proprotein form is developmentally regulated, suggesting its role in testicular development.
In the testis, the early spermatocytes gradually move from the basal compartment towards the adluminal compartment as they mature. During spermatogenesis, this passage is mediated by the morphological intimacy between Sertoli cell tight junctions and the ECM (Cheng and Mruk, 2002). It is also known that the homeostasis of ECM proteins is regulated by the coordinated activity between proteases and protease inhibitors (Werb, 1997; Sternlicht, 2001). Several matrix metalloproteinases are synthesized as active zymogens (pro-MMPs), which undergo an initial proteolytic cleavage, generating an active protein (Araceli et al, 2005). This activation process is largely regulated by tissue inhibitor of metalloproteinase (TIMPS). The interplay between these molecules regulates the remodeling of the ECM (Siu et al, 2003). Several reports indicate that MMPs and TIMPs produced in testicular cells are under the regulation of hormones, such as follicle-stimulating hormone (Ulisse et al, 1994), and cytokines (Walsh et al, 2000) during development. It is important to mention that MT-1 MMP regulates the proteolysis of multifunctional HABP1 (Rozanov et al, 2002). Thus, the role of HABP1 proprotein accumulation either due to higher rates of transcription or lower rates of protein processing in the presence of TIMPs can be correlated with ECM remodeling. We must also note that ECM remodeling is known to play a crucial role in spermatogenesis by regulating the Sertoli cell junction dynamics (Mruk et al, 2004).
Taken together, these observations reveal that HABP1 proprotein accumulation during spermatogenesis occurs specifically in the pachytene spermatocytes and round spermatids, which suggests that HABP1 might play a role in the meiotic and the postmeiotic stages of spermatogenesis and that this accumulation might be further regulated by the important phenomenon of proteolysis.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Cheng CY, Mruk DD. Cell junction dynamics in the testis: SertoliGerm cell interactions and male contraceptive. Dev Physiol Rev. 2002;82: 825 874.
Chinmoy MR, Sharma JD, Chinoy NJ. Altered structural and functional integrity of the reproductive tissue in estradiol-benzoate treated intact male albino rats. Int J Fertil. 1984; 29: 98 103.[Medline]
Chomczynski P, Sacchi N. Single step method of RNA isolation by guanidinium thiocyanate-phenol chloroform extraction. Anal Biochem. 1987;162: 156 159.[Medline]
Das S, Deb TB, Kumar R, Datta K. Multifunctional activities of human fibroblast 34-kda hyaluronic acid binding protein. Gene. 1997;190: 223 225.[CrossRef][Medline]
Deb TB, Datta K. Molecular cloning of human fibroblast hyaluronic acid binding protein confirms its identify with P-32, a protein co-purified with splicing factor SF2. J Biol Chem. 1996; 269: 2206 2212.
Diaz-Perales A, Quesada V, Sànchez LM, Ugalde AP, Suàrez MF, Fueyo A, López-Otin C. Identification of human aminopeptidase O, a novel metalloprotease with structural similarity to aminopeptidase B and leukotriene A4 hydrolase. J Biol Chem. (2005, in press).
Ghosh I, Bharadwaj A, Datta K. Reduction in the level of hyaluronan binding protein 1 (HABP1) is associated with loss of sperm motility. J Reprod Immunol. 2002; 53: 45 54.[CrossRef][Medline]
Ghosh I, Datta K. Sperm surface hyaluronan binding protein (HABP1) interacts with zona pellucida of water buffalo (Bubalus bubalis) through its clustered mannose Residues. Mol Reprod Dev. 2002;64: 235 244.[CrossRef]
Ghosh I, Chowdhury AR, Rajeswari MR, Datta K. Differential expression of hyaluronic acid binding protein 1/P32/C1QBP during progression of epidermal carcinoma. Mol Cell Biochem. 2003; 267: 133 139.[CrossRef]
Gupta S, Datta K. Possible role of hyaluronectin on cell adhesion in rat histiocytoma. Exp Cell Res. 1991; 195: 386 395.[CrossRef][Medline]
Honore B, Madsen P, Rasmussen HH, Vandekerckhove J, Celis JE. Cloning and expression of a cDNA covering the complete coding region of the p32 subunit of human pre-mRNA splicing factor SF2. Gene. 1993;134: 283 287.[CrossRef][Medline]
Jha BK, Salunke DM, Datta K. Disulfide bond formation through Cys186 facilitates functionally relevant dimerization of trimeric hyaluronan-binding protein (HABP1)/p32/gC1qR. Eur J Biochem. 2002;269: 298 306.[Medline]
Laemmli VK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970; 22: 680 685.
Malkov M, Fisher Y, Don J. Development schedule of the postnatal
rat testis determined by flow cytometry. Biol Reprod. 1998; 59: 84
92.
Martin-du Pan RC, Campara A. Physiopathology of spermatogenic arrest. Fertil Steril. 1993; 60: 937 946.[Medline]
Mruk DD, Cheng CY. Sertoli-Sertoli and Sertoli-germ cell
interactions and their significance in germ cell movement in the seminiferous
epithelium during spermatogenesis. Endocr Rev. 2004; 25: 747
806.
Okabe M, Ikawa M, Ashkenas J. Male infertility and the genetics of spermatogenesis. Am J Hum Genet. 1998; 62: 1274 1281.[CrossRef][Medline]
Penttila TL, Yuan L, Mali P, Hoog C, Parvinen M. Haploid gene expression: temporal onset and storage patterns of 13 novel transcripts during rat and mouse spermiogenesis. Biol Reprod. 1995; 53: 499 510.[Abstract]
Ranganathan S, Bharadwaj A, Datta K. Hyaluronan mediates sperm motility by enhancing phosphorylation of proteins including hyaluronan binding protein. Cell Mol Biol Res. 1995; 41: 467 476.[Medline]
Ranganathan S, Ganguly AK, Datta K. Evidence for presence of hyaluronan binding protein on spermatozoa and its possible involvement in sperm function. Mol Reprod Dev. 1994; 38: 69 76.[CrossRef][Medline]
Rao CM, Deb TB, Datta K. Hyaluronic acid induced hyaluronic acid binding protein phosphorylation and inositol triphosphate formation in lymphocytes. Biochem Mol Biol Int. 1996; 40: 327 337.[Medline]
Rozanov DV, Ghebrehiwet B, Postnova TI, Eichinger A, Deryugina EI,
Strongin AY. The hemopexin-like C-terminal domain of membrane type-1 matrix
metalloproteinase regulates proteolysis of a multifunctional protein,gclqR.
J Biol Chem. 2002; 277: 9318
9325.
Siu MKY, Lee WM, Cheng CY. The interplay of collagen IV, tumor
necrosis factor-
, gelatinase B (matrix metalloprotease-9), and tissue
inhibitor of metalloproteases-1 in the basal lamina regulates sertoli
cell-tight junction dynamics in the rat testis.
Endocrinology. 2002; 144: 371
387.
Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD. Measurement of protein using bicinchoninic acid. Anal Biochem. 1985;150: 76 85.[CrossRef][Medline]
Soderstrom KO. Characterization of RNA synthesis in mid-pachytene spermatocytes of the rat. Exp Cell Res. 1976; 102: 237 245.[CrossRef][Medline]
Sternlicht MD, Werb Z. How matrix metalloproteinases regulate cell behaviour. Annu Rev Cell Dev Biol. 2001; 17: 463 516.[CrossRef][Medline]
Toole BP. Hyaluronan is not just a goo! J Clin Invest. 2000;106: 335 336.[Medline]
Turley EA, Noble PW, Bourguignon LYW. Signaling properties of
hyaluranan receptors. J Biol Chem. 2002; 277: 4589
4592.
Ulisse S, Farina AR, Piersanti D, Tiberio A, Cappabianca L, D'Orazi G, Jannini EA, Malykh O, Stetler-Stevenson WG, D'Armiento M. Follicle-stimulating hormone increases the expression of tissue inhibitors of metalloproteinases TIMP-1 and TIMP-2 and induces TIMP-1 AP-1 site binding complex(es) in prepubertal rat sertoli cells. Endocrinology. 1994; 135: 2479 2487.[Abstract]
Werb Z. ECM and cell surface proteolysis: regulating cellular ecology. Cell. 1997; 91: 439 442.[CrossRef][Medline]
Wolgemuth DJ, Watrin F. List of cloned mouse genes with unique expression patterns during spermatogenesis. Mamm Genom. 1991;1: 283 288.
This article has been cited by other articles:
![]() |
V. Kumar, M. M. Misro, and K. Datta Simultaneous Accumulation of Hyaluronan Binding Protein 1 (HABP1/p32/gC1qR) and Apoptotic Induction of Germ Cells in Cryptorchid Testis J Androl, January 1, 2012; 33(1): 114 - 121. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Jiang, J. Liang, and P. W. Noble Hyaluronan as an Immune Regulator in Human Diseases Physiol Rev, January 1, 2011; 91(1): 221 - 264. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |