| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


From the Departments of * Urology and
Cell Biology, University of Virginia School of
Medicine, Charlottesville, Virginia; and the
Department of Contraception, Women's Health
Research Institute, Wyeth Research, Collegeville, Pennsylvania.
| Correspondence to: Terry T. Turner, PhD, Department of Urology, University of Virginia School of Medicine, PO Box 800422, Charlottesville, VA 22908 (e-mail: ttt{at}virginia.edu). |
| Received for publication June 21, 2005; accepted for publication August 18, 2005. |
| Abstract |
|---|
|
|
|---|
Key words: Hedgehog genes, epididymal regulation, posttesticular sperm development
There is also precedence for Hh expression in adult tissues. Dhh functions in the adult mouse testis in a stage-specific manner (Bitgood et al, 1996), and Shh has recently been shown to be expressed at both the gene and protein levels in the adult mouse epididymis (Turner et al, 2004). In the latter study, gene expression for the Shh receptor, patched-1 (Ptc1), and one of the pathway's downstream transcription factors, Gli1, were also present in the adult mouse epididymis, and Shh protein was immunolocalized to the epididymal epithelium. Also in that study, Shh expression occurred in all 3 epididymal regions: caput, corpus, and cauda, increasing distally at both the gene and protein levels.
Beyond the 3 traditional regions of the epididymis, the organ is divided into intraregional segments (Turner et al, 2003) that exhibit unique expression profiles for a number of known genes or proteins (Kirchhoff, 1999; Bomgardner et al, 2001), and it has recently been shown that this segmental regulation occurs with literally thousands of genes across the epididymal transcriptome (Johnston et al, 2005). This information has raised 3 questions addressed in the present report: 1) Are Shh pathway genes in the epididymis differentially expressed between intraregional segments? 2) Does Shh pathway activity have any functional meaning in the epididymis with regard to sperm maturation? 3) If so, what are likely target genes for Shh pathway activity? We have addressed these questions in the mouse epididymis.
| Materials and Methods |
|---|
|
|
|---|
Cluster Analysis of Shh Gene Expression as a Guide to Potential Target Genes![]()
Identification of transcripts with expression patterns similar to Shh
(Affymetrix fragment 1436689_at) were identified by querying the database of
Johnston et al (2005) for gene
expression values from each of the 10 segments of the mouse epididymis using
the Contrast Analysis tool within Genesis 2.5 (GeneLogic). Two separate
analyses were performed to determine transcripts with a Pearson correlation
value of greater than 0.93 and 0.95.
Cyclopamine Administration![]()
Ptc1, a membrane receptor for Shh, binds to another membrane protein,
smoothened (Smo), when not occupied by its ligand. Upon binding to Shh, Ptc1
releases Smo, which initiates an intracellular cascade leading to the movement
of Gli transcription factors to their target sequences in the nucleus. The
Veratum alkaloid cyclopamine blocks Shh signaling
(Keeler and Baker, 1989; Lamm et al, 2002) by binding
to and inactivating Smo (Chen et al,
2002). Cyclopamine (8 µg/µL dimethylformamide [DMF; Sigma
Chemical Co, St Louis, Mo]) was administered to adult male mice (n = 10) with
subcutaneous osmotic minipumps (model 1002, Alzet Corp, Cupertino, Calif)
delivering 48 µg cyclopamine/animal/d, or approximately 2 mg/kg body
weight/d for 14 days. This dose has previously proven effective in suppressing
the Shh pathway in the mouse (Van Den
Brink et al, 2001). Sham control animals (n = 10) were implanted
with identical minipumps delivering DMF alone.
On day 14 the animals were anesthetized and subjected to one of 3 procedures: 1) unilateral testicular and epididymal collection with immediate fixation in Bouin solution followed by paraffin embedding, sectioning, and staining with hematoxylin-eosin for histological evaluation (n = 5); 2) unilateral in vivo micropuncture for collection of cauda sperm and subsequent sperm motility studies (n = 5); or 3) bilateral epididymal extirpation followed by RNA isolation and detection of Gli1 and Gli3 (n = 5) expression using semiquantitative reverse transcriptasepolymerase chain reaction (sq-RT-PCR). The RNA of 5 epididymides was used for preliminary experiments in establishing conditions for the sq-RT-PCR.
Testicular and epididymal histology were evaluated qualitatively for completeness of spermatogenesis and normal spermatogenic patterns within the seminiferous epithelia. Further, spermatogenesis was evaluated semiquantitatively by a modified Johnsen score (Johnsen, 1970) of 10 different seminiferous tubules per testis of 5 testes in each group. In this modification of a human assay for the mouse, the scoring criteria were for each tubule examined rather than for the entire testis. The scoring criteria are described as follows: 5, complete spermatogenesis appropriate for stage of cycle; 4, incomplete spermatogenesis but some disorganization evident within the epithelium; 3, incomplete spermatogenesis with missing germ cell types down to spermatocytes; 2, germ cells missing down to spermatogonia; 1, no germ cells present within the seminiferous tubule, Sertoli cells only; and 0, no cells within tubule lamina propria. Overall epididymal histology was evaluated qualitatively, and epididymal epithelial heights were measured in segments 1 and 2 of sham-infused and cyclopamine-infused animals.
sq-RT-PCR![]()
Gene expression for Gli1 and Gli3 in the intact mouse
epididymis was determined by sq-RT-PCR. Epididymides were frozen in liquid
nitrogen immediately after dissection and were ground using a prechilled
mortar and pestle. RNA was extracted from the powdered, frozen tissue using a
phenol/guanidine isothiocyanate mixture (TRIzol, Invitrogen; Carlsbad, Calif)
according to manufacturer instructions and was treated with DNAse I
(Invitrogen) for 15 minutes. In some cases, the integrity of the RNA was
checked using denaturing agarose gels containing formaldehyde. Complementary
DNA (cDNA) was obtained using the SuperScript First-Strand Synthesis System
(Invitrogen) from 1 µg total RNA using random hexamers according to
manufacturer instructions. The PCR was performed using Platinum High-Fidelity
Taq Polymerase (Invitrogen) and forward and reverse primers for Gli1
(TGCCAGATATGCTTCAGCCA and TGTGGCGAATAGACAGAGGT) and Gli3
(GAACAGTGTGAGGAGAGACAG-CGAC and GAACTGACCTCGTTCCACTGGATG). Primers and
competimers for 18s rRNA (Quantum mRNA 18s Internal Standards, Ambion, Austin,
Tex) were also included to obtain 18s bands that were used to normalize the
Gli bands. Amount of competimer was adjusted to obtain 18s bands of the
similar magnitude as the Gli bands. PCR was carried out using annealing and
extension temperatures of 60°C and 68°C for 30 seconds and 75 seconds,
respectively. We determined the amount of PCR products, both Gli and 18s,
developed through 32 cycles and demonstrated linear increases in product (not
shown). Thus, for valid quantitative measurements, PCR reactions were carried
out for 31 cycles. The intensity of the bands was measured using the Quantity
One image system (Bio-Rad, Hercules, Calif). Controls for DNA contamination
were included in each gel by either omitting the RT in the cDNA synthesis
reaction or by omitting the template in the PCR reaction. Gels were stained
with ethidium bromide.
|
In Vivo Micropuncture and Microassay for Sperm Motility![]()
Epididymides of anesthetized animals (n = 5/group) were exteriorized and
subjected to in vivo micropuncture of the distal cauda tubules
(Figure 1A, segment 10) using
techniques previously described (Turner,
1985; Turner and Bomgardner,
2002) but modified for the mouse. Briefly, the exposed cauda was
viewed through a dissecting microscope and was micropunctured with a sharpened
glass micropipette (50-µm tip opening) attached to a micromanipulator.
Cauda content (approximately 100 nL/sample) was collected by applying
carefully controlled negative pressure through a PE50 polyethylene cannula
attached to a glass syringe and to the micropipette. The motility of cauda
spermatozoa was determined using a microassay for sperm motility, as described
previously for the rat (Turner and
Howards, 1978; Turner and
Giles, 1982; Turner and Reich,
1987) but modified for the mouse. Briefly, 1-µL volumes of 0.9%
saline were deposited under mineral oil in both wells of 2-well culture slides
maintained at 32°C. Duplicate aliquots of cauda content (50 nL each) were
deposited directly from their collection pipette into the 2 saline drops under
oil, and sperm motility in the samples was assessed in duplicate under
100x magnification using a 04 scoring system. Motility was scored
in whole numbers only (0 = no motility, 4 = maximum perceived motility)
beginning immediately (time 0) and continuing thereafter every 15 minutes for
2 hours. This qualitative assay for sperm motility has the benefits of
allowing examination of motility immediately upon collection from the cauda
lumen, it allows assessment of motility without contaminating factors from
other fluid compartments, and it allows a standardized, although qualitative,
assessment of sperm motility when those sperm can only be collected in
extremely small volumes.
To assess whether cyclopamine in epididymal fluid was having a direct
effect on sperm motility, cauda sperm were collected from control animals and
diluted 1:20 in either saline alone, 1: 100 DMF:saline, or 1:100 DMF
containing 0.27 µg cyclopamine:saline (for a final concentration of
0.027 µg cyclopamine/mL diluent). Motility was assessed as described
above.
Neither the clearance rate nor tissue distribution of cyclopamine is known for the mouse or any other species, although it is presumed to be quite rapid (Gaffield, personal communication); thus, estimates of intraepididymal cyclopamine concentrations had to be based on several broad assumptions regarding total body water, equivalent distribution of cyclopamine across all body compartments, and rapid clearance. These assumptions led to the calculated value of 0.027 µg cyclopamine/mL as the concentration of cyclopamine potentially in cauda lumen fluid during the period of cyclopamine administration via the osmotic minipumps.
Statistics![]()
Two-group comparisons were by Student's t test or paired
t test, as appropriate, and multiple comparisons were by analysis of
variance followed by Tukey range test;
equals .05 in all cases.
| Results |
|---|
|
|
|---|
85 and Gli1 mean
expression
65; background = 50), but without significant pattern
(results not shown). Gli3 expression was also without pattern between
segments, but its average expression values were approximately 5 times those
of Gli1 (mean
275). Gli2 expression was not
detectable by microarray analysis of the mouse epididymal transcriptome; thus,
no further work was done with this gene.
|
|
In a separate experiment, control cauda sperm diluted 1:20 in saline, saline + DMF, or saline + DMF + 0.027 µg cyclopamine/mL did not exhibit any differences in either the initiation or duration of motility (Figure 3B).
The qualitative histology of the testes and epididymides of animals after 14-day cyclopamine exposure was identical to that of sham controls. Complete spermatogenesis appropriate to stage was ongoing in testes of both groups of animals. Johnsen scores (mean ± SEM) of testes from sham-infused and cyclopamine-infused animals were 4.86 ± 0.06 and 4.92 ± 0.04, respectively, reflecting completely normal spermatogenesis. There were sperm in the epididymal lumena of all animals, and the tubule epithelia in the various segments appeared completely normal. Measured epididymal epithelial heights (mean ± SEM) in segments 1 and 2 of sham-infused and cyclopamine-infused animals were 44.5 ± 0.9 µm, 27.2 ± 0.7 µm, 45.2 ± 1.1 µm, and 26.5 ± 0.9 µm, respectively.
Cluster Analysis for Potential Gene Targets of the Shh Pathway![]()
Cluster analysis for Shh gene expression was performed to
determine which genes are expressed in the mouse epididymis in a segmental
pattern similar to Shh. This analysis was performed at both the 95%
and the 93% confidence limits using the data set from the mouse epididymal
transcriptome generated by our lab
(Johnston et al, 2005). At the
95% confidence limits, 2 known genes are expressed in a pattern similar to
Shh: SET and MYND domain containing 2 (Smyd2) and
Ptgds. At the 93% confidence limits, another 7 known genes were
expressed in a pattern similar to Shh. These were DAZ-associated
protein 2 (Dazap2), cytoskeletal-associated protein 4
(Ckap4), nuclear factor, erythroid-derived 2
(Nfe212), dipeptidylpeptidase 4 (Dpp4), pre-B
cell leukemia transcription factor 1 (Pbx1), PCTAIRE-motif
protein kinase 1 (Pctk1), and N-myristoyltransferase 2
(Nmt2). Gene expression values of Ptgds were particularly
robust and followed the pattern of Shh very closely
(Figure 4A and B). Expression
of Ckap4, as an example from the 93% confidence group, was typical of
the genes more modestly expressed than Shh and which followed the
Shh pattern less closely (Figure
4C). All of the genes in these clusters rose rapidly in expression
through segments 13 and 4, then either declined or stayed flat through
segments 58 and increased again in segments 910 or 10 alone, but
none followed the pattern of Shh more closely than
Ptgds.
|
|
| Discussion |
|---|
|
|
|---|
An important aspect of epididymal function is the ability to maintain a luminal microenvironment conducive to the maturation of sperm, and one measure of sperm maturity is their capacity for motility after transit through the epididymis. Immature sperm swim poorly or not at all, and mature sperm express a high degree of progressive motility (Turner and Howards, 1978; Yeung and Cooper, 2002). In the present work we have administered the Shh pathway inhibitor cyclopamine for a period long enough to have allowed mouse cauda sperm to make their complete epididymal transit in an epididymis with an inhibited Shh pathway. At that time we assessed cauda sperm for the ability to initiate and maintain motility, and we assayed epididymal RNA for evidence that the Shh pathway had, indeed, been inhibited.
First, microarray results from all 10 epididymal segments confirmed the overall Shh expression pattern previously reported for 3 regions: caput, corpus, and cauda (Turner et al, 2004; ie, Shh expression increases distally) (Figure 1). The microarray results gave more detail to the expression pattern than was known previously and allowed subsequent cluster analysis for genes of similar expression patterns (see below). Also, the microarray analysis of epididymal gene expression showed that, similar to our previous results using sq-RT-PCR (Turner et al, 2004), Gli1 expression does not change significantly along the length of the mouse epididymis. Interestingly, however, the microarray analysis demonstrated that Gli3 expression levels were much higher than those of Gli1, although again, there was no discernable pattern of expression across the epididymal segments. Because of its relatively high expression upon microarray analysis, Gli3 was included in the subsequent investigation.
Gli1 is a positive-regulating transcription factor of the Shh signaling pathway and is induced by Shh in a number of tissues (Marigo et al, 1996; Dahmane et al, 1997; Lee et al, 1997); thus, in the present study, Gli1 expression was used as a marker for cyclopamine effects on the Shh pathway. Gli activities are complex, however, and not all Gli's respond or act similarly. Gli3, for example, is reportedly repressed, not induced, by Shh during development and is a repressor rather than an inducer of gene transcription (Ruiz-Altaba, 1999). On the other hand, in NIH3T3 cells, Gli3 binds to the Gli1 promoter and induces Gli1 transcription in response to Shh (Dai et al, 1999). Further, in zebrafish, Gli3 acts as both an activator and a repressor (Tyurina et al, 2005). These findings made it difficult to predict what result Shh pathway inhibition would have on Gli3 transcription, but the gene was included in our study for the reasons stated above.
Sq-RT-PCR for Gli1 and Gli3 validated the microarray results (ie, Gli3 is more highly expressed in the mouse epididymis than Gli1) (Figure 2A). Further, cyclopamine treatment for 2 weeks reduced expression of Gli1 by more than half (Figure 2B) in the absence of any change in testis morphology, indicating that the cyclopamine treatment produced an inhibition of the Shh pathway, as it had previously (Van Den Brink et al, 2001), and without significant change to the animals' endocrine status. The treatment also reduced Gli3 expression (Figure 2B), indicating that the regulation of this gene in the adult may also be dependent on the ligation of Ptc1 to Shh. The cyclopamine treatment did not change epididymal morphology, thus indicating that the changes in the epithelium did not involve morphology, but perhaps a more subtle secretory or metabolic process.
It would have been interesting to know the regional or even segmental responses of the epididymis to cyclopamine treatment vis-à-vis Gli expressions, but intact epididymides were used for this part of the study for reasons of simplicity and economy. The information gained was sufficient to determine that cyclopamine did, in fact, inhibit epididymal Gli expression. Further, the lack of any effect of cyclopamine on testicular or epididymal size or histology implies there was no biologically significant effect on testicular or pituitary hormones.
Inhibition of the Shh pathway during epididymal transit was associated with a reduction in the capacity of cauda sperm to initiate motility when diluted 1:20 in assay diluents (Figure 3A). That this was not a direct effect of cyclopamine on cauda sperm is indicated by the absence of effect of cyclopamine when added directly to the sperm diluent (Figure 3B). This was an acute exposure, however, and it is recognized that this does not absolutely rule out the possibility that long-term exposure of sperm to small amounts of cyclopamine in the epididymal fluid might affect the expression of motility. There is no evidence to indicate that this might be so, nor is there a known mechanism by which it might occur.
The finding that an uninhibited Shh pathway in the epididymis is important for the development of sperm motility is novel and raises the question of gene targets for the pathway in the epididymis. In embryonic tissues, Shh signaling has been shown to have a variety of Fgf, Bmp, Wnt, and Pax genes as targets (Christ et al, 1998; Perriton et al, 2002; Scherz et al, 2004), but no genes in these families were detected as co-expressors with Shh in the adult mouse epididymis. Rather, the known genes with expression patterns closest to that of Shh (95% confidence level) were Ptgds and Smyd2. Smyd2 is a gene of unknown function and is poorly expressed (expression values 40140), whereas Ptgds is known to be a prominently synthesized and secreted protein in the epididymis of other species (Turner et al, 2000; Dacheux et al, 2003), and Ptgds was highly expressed in the distal segments of the mouse epididymis, whether assessed by microarray analysis (Figure 4) or sq-RT-PCR (Figure 5). The utility of this secreted protein in the epididymal lumen remains unknown, although its absence in bull seminal plasma is associated with infertility (Gerena et al, 1998). These associations make Ptgds a potential target of the Shh pathway and an interesting target for further investigation.
We recognize that the fidelity of a gene's expression pattern with that of a signal molecule is not a guarantee of a signal-target relationship. Neither is the level of gene expression necessarily an indicator of the importance of the gene product; therefore, the other genes highlighted in our cluster analysis at both the 95% and 93% level of confidence will remain as candidate target genes of the Shh pathway in the mouse epididymis.
It is interesting that in neither the present study nor that conducted previously using a different assay (Turner et al, 2004) have Ptc1 and Gli1 followed the Shh expression pattern, yet when the Shh pathway is inhibited with cyclopamine, Gli expressions decline. It could be that some threshold level of Smo activation is required to maintain rather tonic Gli expression levels across the epididymal segments, but failing that Smo activation, Gli expressions are reduced.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Bomgardner D, Hinton BT, Turner TT. Hox transcription factors may play a role in regulating segmental function of the adult epididymis. J Androl. 2001;22: 527 -531.[Medline]
Chen JK, Taipale J, Cooper MK, Beachy PA. Inhibition of Hedgehog
signaling by direct binding of cyclopamine to Smoothened. Genes
Dev. 2002;16: 2743
-2748.
Christ B, Schmidt C, Huqang R, Wilting J, Brand-Saberi B. Segmentation of the vertebrate body. Anat Embryol. 1998; 197: 1 -8.[Medline]
Dacheux JL, Gatti JL, Castella S, Metayer S, Fouchecourt S, Dacheux F. The epididymal proteome. In: Hinton BT, Turner TT, eds. The Third International Conference on the Epididymis. Charlottesville, Va: The Van Doren Company; 2003: 115 -122.
Dahmane N, Lee J, Robins P, Ruiz-Altaba A. Activation of the transcription factor Gli1 and the sonic hedgehog signaling pathway in skin tumors. Nature. 1997; 389: 876 -891.[CrossRef][Medline]
Dai P, Akimaru H, Tanaka Y, Maekawa T, Nakafuku M, Ishii S. Sonic
hedgehoginduced activation of the Gli1 promoter is mediated by
GLI3. J Biol Chem. 1999; 274: 8143
-8152.
Gerena RL, Irikura D, Urade N, Eguhi N, Chapman DA, Killian GJ.
Identification of the fertility associated protein in bull seminal plasma as
lipocalin-type, prostaglandin D2 synthase. Biol
Reprod. 1998;58: 826
-833.
Hammerschmidt M, Brook A, McMahon AP. The world according to hedgehog. Trends Genet. 1997; 13: 14 -21.[CrossRef][Medline]
Ingham PW, McMahon AP. Hedgehog signaling in animal development:
paradigms and principles. Genes Dev. 2001; 15: 3059
-3087.
Johnsen SG. Testicular biopsy score counta method for registration of spermatogenesis in human testes: normal values and results in 335 hypogonadal males. Hormones. 1970; 1: 2 -25.[Medline]
Johnston DS, Jelinsky SA, Bang HJ, DiCandeloro P, Wilson E, Kopf
GA, Turner TT. The murine epididymal transcriptome: transcriptional profiling
of segmental gene expression in the epididymis. Biol
Reprod. 2005;73: 404
-413.
Keeler RF, Baker DC. Oral, osmotic minipump, and intramuscular
administration to sheep of the Veratum alkaloid, cyclopamine.
Proc Soc Exp Biol Med. 1989; 192: 153
-156.
Kirchhoff C. Gene expression in the epididymis. Int Rev Cytol. 1999;188: 133 -202.[Medline]
Lamm MLG, Catbagan WS, Laciak RJ, Barnett DH, Hebner CM, Gaffield W, Walterhouse D, Iannaccone P, Bushman W. Sonic hedgehog activates mesenchymal Gli1 expression during prostate ductal bud formation. Dev Biol. 2002; 249: 349 -366.[CrossRef][Medline]
Lee J, Platt KA, Censullo P, Ruiz-Altaba A. Gli1 is a target of Sonic hedgehog that induces ventral neural tube development. Development. 1997; 124: 2537 -2552.[Abstract]
Marigo V, Johnson RL, Vortkamp A, Tabin CJ. Sonic hedgehog differentially regulates expression of GLI1 and GLI3 during limb development. Dev Biol. 1996; 180: 273 -283.[CrossRef][Medline]
Nybakken K, Perrimon N. Hedgehog signal transduction: recent findings. Curr Opin Gene Dev. 2002; 12: 503 -511.[CrossRef][Medline]
Perriton CL, Powles N, Chiang C, Maconochie MK, Cohn MJ. Sonic hedgehog signaling from the urethral epithelium controls external genital development. Dev Biol. 2002; 247: 26 -46.[CrossRef][Medline]
Podlasek CA, Barnett DH, Clemens JQ, Bak PM, Bushman W. Prostate development requires Sonic hedgehog expressed by the urogenital sinus epithelium. Dev Biol. 1999; 209: 28 -39.[CrossRef][Medline]
Ruiz-Altaba A. Gli proteins and hedgehog signaling. Trend Genet. 1999; 15 : 418-425.[CrossRef][Medline]
Scherz PH, Harfe BD, McMahon AP, Tabin CJ. The limb bud Shh-Fgf
feedback loop is terminated by expansion of former ZPA cells.
Science. 2004;305: 396
-399.
Turner TT. Transepithelial movement of 3H-androgen in seminiferous and epididymal tubules: a study using in vivo micropuncture and in vivo microperfusion. Biol Reprod. 1985; 39: 399 -408.
Turner TT, Bomgardner D. On the regulation of Crisp-1 mRNA expression and protein secretion by luminal factors presented in vivo by microperfusion of the rat proximal caput epididymidis. Mol Reprod Dev. 2002;61: 437 -444.[CrossRef][Medline]
Turner TT, Bomgardner DA, Jacobs JP. Sonic hedgehog pathway genes
are expressed and transcribed in the adult mouse epididymis. J
Androl. 2004;25: 514
-522.
Turner TT, Bomgardner D, Jacobs JP, and Nguyen QAT. Association of segmentation of the epididymal interstitium with segmented tubule function in rats and mice. Reproduction. 2003; 125: 871 -878.[Abstract]
Turner TT, Giles RD. The effects of cyclic adenine nucleotides, phosphodiesterase inhibitors, and cauda epididymidal fluid on the motility of rat epididymal spermatozoa. J Androl. 1982; 3: 134 -139.[Abstract]
Turner TT, Howards SS. Factors involved in the initiation of sperm motility. Biol Reprod. 1978; 18: 571 -578.[Abstract]
Turner TT, Reich GW. Influence of proteins in the rat cauda epididymal lumen fluid on cauda sperm motility. Gamete Res. 1987;18: 267 -278.[Medline]
Turner TT, Riley TA, Vagnetti M, Flickinger CA, Caldwell JA, Hunt DF. Post-vasectomy alterations in protein synthesis and secretion in the rat caput epididymidis are not repaired after vasovasostomy. J Androl. 2000;2: 276 -290.
Tyurina OV, Popova GB, Feng E, Schier J, Kohtz AF, Karlstrom RO. Zebrafish Gli3 functions as both an activator and a repressor in Hedgehog signaling. Dev Biol. 2005; 277: 537 -556.[CrossRef][Medline]
Van Den Brink GR, Hardwick JCH, Tytgat GNJ, Brink MA, Ten Kate PJ, Van Deventer SJH, Peppelenbosch MP. Sonic hedgehog regulates gastric gland morphogenesis in man and mouse. Gastroenterology. 2001; 121: 317 -328.[CrossRef][Medline]
Villavicencio EH, Walterhouse DO, Iannaccone PM. The sonic hedgehog-patched-gli pathway in human development and disease. Am J Hum Genet. 2000;67: 1047 -1054.[Medline]
Yeung CH, Cooper TG. Acquisition and development of sperm motility upon maturation in the epididymis. In: Robaire B, Hinton BT, eds. The Epididymis From Molecules to Clinical Practice. New York, NY: Kluwer Academic/Plenum Publishers; 2002: 417 -434.
Yongbing P, Huang L, Prins GS. Sonic hedgehog-patched-Gli signaling in the developing rat prostate gland: lobe-specific suppression by neonatal estrogens reduces ductal growth and branching. Dev Biol. 2004; 273: 257 -275.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. Wu, S. Zhang, and X. Sun Neuroprotective Effect of Upregulated Sonic Hedgehog in Retinal Ganglion Cells Following Chronic Ocular Hypertension Invest. Ophthalmol. Vis. Sci., June 1, 2010; 51(6): 2986 - 2992. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Cornwall New insights into epididymal biology and function Hum. Reprod. Update, March 1, 2009; 15(2): 213 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Lipinski, P. R. Hutson, P. W. Hannam, R. J. Nydza, I. M. Washington, R. W. Moore, G. G. Girdaukas, R. E. Peterson, and W. Bushman Dose- and Route-Dependent Teratogenicity, Toxicity, and Pharmacokinetic Profiles of the Hedgehog Signaling Antagonist Cyclopamine in the Mouse Toxicol. Sci., July 1, 2008; 104(1): 189 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Turner De Graaf's Thread: The Human Epididymis J Androl, May 1, 2008; 29(3): 237 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Tomsig, S. Usanovic, and T. T. Turner Growth Factor-Stimulated Mitogen-Activated Kinase (MAPK) Phosphorylation in the Rat Epididymis Is Limited by Segmental Boundaries Biol Reprod, October 1, 2006; 75(4): 598 - 604. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Tomsig and T. T. Turner Growth Factors and the Epididymis J Androl, May 1, 2006; 27(3): 348 - 357. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |