Journal of Andrology Cross-Journal Searching
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published-Ahead-of-Print November 8, 2005, DOI:10.2164/jandrol.05114
Journal of Andrology, Vol. 27, No. 2, March/April 2006
Copyright © American Society of Andrology
DOI: 10.2164/jandrol.05114

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
27/2/225    most recent
Author Manuscript (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Turner, T. T.
Right arrow Articles by Tomsig, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Turner, T. T.
Right arrow Articles by Tomsig, J. L.

Sonic Hedgehog Pathway Inhibition Alters Epididymal Function as Assessed by the Development of Sperm Motility

TERRY T. TURNER*,{dagger}, HYUN J. BANG*, SHARON A. ATTIPOE*, DANIEL S. JOHNSTON{ddagger} AND JOSE L. TOMSIG*

From the Departments of * Urology and {dagger} Cell Biology, University of Virginia School of Medicine, Charlottesville, Virginia; and the {ddagger} Department of Contraception, Women's Health Research Institute, Wyeth Research, Collegeville, Pennsylvania.

Correspondence to: Terry T. Turner, PhD, Department of Urology, University of Virginia School of Medicine, PO Box 800422, Charlottesville, VA 22908 (e-mail: ttt{at}virginia.edu).
Received for publication June 21, 2005; accepted for publication August 18, 2005.

   Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The sonic hedgehog (Shh) signaling pathway plays a role in pattern orientation in the developing embryo and has been shown to be required for development of the prostate and external genitalia. Recent evidence has shown that important elements of the Shh pathway are also expressed in the adult mouse epididymis at both the gene and protein levels. The objective of the present investigation was to refine the expression pattern of Shh in the mouse epididymis and to determine if the Shh pathway is important for epididymal function vis-à-vis sperm maturation. The former was achieved by microarray analysis of Shh expression in all segments of the mouse epididymis, and the latter was determined by 14-day administration of cyclopamine, a Shh pathway inhibitor, followed by a microassay for the activation and duration of cauda epididymal sperm motility. Shh pathway inhibition was monitored by semiquantitative reverse transcriptase–polymerase chain reaction for expression of epididymal Gli1 and Gli3. The Gli family of transcription factors is commonly activated and regulated by Shh pathway activation. Cyclopamine treatment reduced Gli1 expression by 61% and initiation of cauda sperm motility by 50%. Gli3 expression was reduced by approximately 50%. Subsequent cluster analysis using the microarray data on epididymal gene expression highlighted several potential target genes for the Shh pathway, the most prominent of which is prostaglandin D2 synthase. These results indicate that an operating Shh pathway is important in the murine epididymis for the development of sperm motility and implies a role for Shh signaling in adult epididymal function.

     Key words: Hedgehog genes, epididymal regulation, posttesticular sperm development



Hedgehog (Hh) proteins are extracellular signaling molecules first identified in Drosophila but later identified in other phyla, including mammals (Hammerschmidt et al, 1997; Ingham and McMahon, 2001). The Hh family members, Sonic hedgehog (Shh), Indian hedgehog, and Desert hedgehog (Dhh), regulate numerous patterning processes during embryonic development. In the male reproductive tract, for example, Dhh has been localized in Sertoli cells, where it plays a role in germ cell development (Bitgood et al, 1996), and Shh signaling is important in both the developing prostate (Lamm et al, 2002; Yongbing et al, 2004) and external genitalia (Perriton et al, 2002).

There is also precedence for Hh expression in adult tissues. Dhh functions in the adult mouse testis in a stage-specific manner (Bitgood et al, 1996), and Shh has recently been shown to be expressed at both the gene and protein levels in the adult mouse epididymis (Turner et al, 2004). In the latter study, gene expression for the Shh receptor, patched-1 (Ptc1), and one of the pathway's downstream transcription factors, Gli1, were also present in the adult mouse epididymis, and Shh protein was immunolocalized to the epididymal epithelium. Also in that study, Shh expression occurred in all 3 epididymal regions: caput, corpus, and cauda, increasing distally at both the gene and protein levels.

Beyond the 3 traditional regions of the epididymis, the organ is divided into intraregional segments (Turner et al, 2003) that exhibit unique expression profiles for a number of known genes or proteins (Kirchhoff, 1999; Bomgardner et al, 2001), and it has recently been shown that this segmental regulation occurs with literally thousands of genes across the epididymal transcriptome (Johnston et al, 2005). This information has raised 3 questions addressed in the present report: 1) Are Shh pathway genes in the epididymis differentially expressed between intraregional segments? 2) Does Shh pathway activity have any functional meaning in the epididymis with regard to sperm maturation? 3) If so, what are likely target genes for Shh pathway activity? We have addressed these questions in the mouse epididymis.


   Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Segmental Analysis of Shh Expression

Shh, Ptc1, Gli1, Gli2, and Gli3 expression in each segment of the mouse epididymis were investigated using the mouse transcriptome database recently generated by our laboratory (Johnston et al, 2005) and available at http://mrg.genetics.washington.edu. Briefly, adult mouse (C57BL/6) epididymides were harvested, placed in ice-cold saline, and dissected into the 10 epididymal segments of that species (Johnston et al, 2005). Here and elsewhere, all animal experiments were conducted with protocols approved by our institutional animal care and use committee. RNA was isolated and multiple, independent samples from each segment (n = 4–8, each) were submitted to microarray analysis using the MOE430 chipset (Affymetrix, Santa Clara, Calif), which assays for the expression of 32 000 transcripts. Signal values were determined within each array using the Gene Chip Operating System 1.0 (GCOS, Affymetrix). Signal values were imported into Genesis 2.0 (GeneLogic, Gaithersburg, Md) for analysis. A gene's expression was considered detectable in a segment if its mean signal value was greater than 50 and if it was called "present" greater than or equal to 66% of the time for all chips assaying gene expression in that segment.

Cluster Analysis of Shh Gene Expression as a Guide to Potential Target Genes

Identification of transcripts with expression patterns similar to Shh (Affymetrix fragment 1436689_at) were identified by querying the database of Johnston et al (2005) for gene expression values from each of the 10 segments of the mouse epididymis using the Contrast Analysis tool within Genesis 2.5 (GeneLogic). Two separate analyses were performed to determine transcripts with a Pearson correlation value of greater than 0.93 and 0.95.

Cyclopamine Administration

Ptc1, a membrane receptor for Shh, binds to another membrane protein, smoothened (Smo), when not occupied by its ligand. Upon binding to Shh, Ptc1 releases Smo, which initiates an intracellular cascade leading to the movement of Gli transcription factors to their target sequences in the nucleus. The Veratum alkaloid cyclopamine blocks Shh signaling (Keeler and Baker, 1989; Lamm et al, 2002) by binding to and inactivating Smo (Chen et al, 2002). Cyclopamine (8 µg/µL dimethylformamide [DMF; Sigma Chemical Co, St Louis, Mo]) was administered to adult male mice (n = 10) with subcutaneous osmotic minipumps (model 1002, Alzet Corp, Cupertino, Calif) delivering 48 µg cyclopamine/animal/d, or approximately 2 mg/kg body weight/d for 14 days. This dose has previously proven effective in suppressing the Shh pathway in the mouse (Van Den Brink et al, 2001). Sham control animals (n = 10) were implanted with identical minipumps delivering DMF alone.

On day 14 the animals were anesthetized and subjected to one of 3 procedures: 1) unilateral testicular and epididymal collection with immediate fixation in Bouin solution followed by paraffin embedding, sectioning, and staining with hematoxylin-eosin for histological evaluation (n = 5); 2) unilateral in vivo micropuncture for collection of cauda sperm and subsequent sperm motility studies (n = 5); or 3) bilateral epididymal extirpation followed by RNA isolation and detection of Gli1 and Gli3 (n = 5) expression using semiquantitative reverse transcriptase–polymerase chain reaction (sq-RT-PCR). The RNA of 5 epididymides was used for preliminary experiments in establishing conditions for the sq-RT-PCR.

Testicular and epididymal histology were evaluated qualitatively for completeness of spermatogenesis and normal spermatogenic patterns within the seminiferous epithelia. Further, spermatogenesis was evaluated semiquantitatively by a modified Johnsen score (Johnsen, 1970) of 10 different seminiferous tubules per testis of 5 testes in each group. In this modification of a human assay for the mouse, the scoring criteria were for each tubule examined rather than for the entire testis. The scoring criteria are described as follows: 5, complete spermatogenesis appropriate for stage of cycle; 4, incomplete spermatogenesis but some disorganization evident within the epithelium; 3, incomplete spermatogenesis with missing germ cell types down to spermatocytes; 2, germ cells missing down to spermatogonia; 1, no germ cells present within the seminiferous tubule, Sertoli cells only; and 0, no cells within tubule lamina propria. Overall epididymal histology was evaluated qualitatively, and epididymal epithelial heights were measured in segments 1 and 2 of sham-infused and cyclopamine-infused animals.

sq-RT-PCR

Gene expression for Gli1 and Gli3 in the intact mouse epididymis was determined by sq-RT-PCR. Epididymides were frozen in liquid nitrogen immediately after dissection and were ground using a prechilled mortar and pestle. RNA was extracted from the powdered, frozen tissue using a phenol/guanidine isothiocyanate mixture (TRIzol, Invitrogen; Carlsbad, Calif) according to manufacturer instructions and was treated with DNAse I (Invitrogen) for 15 minutes. In some cases, the integrity of the RNA was checked using denaturing agarose gels containing formaldehyde. Complementary DNA (cDNA) was obtained using the SuperScript First-Strand Synthesis System (Invitrogen) from 1 µg total RNA using random hexamers according to manufacturer instructions. The PCR was performed using Platinum High-Fidelity Taq Polymerase (Invitrogen) and forward and reverse primers for Gli1 (TGCCAGATATGCTTCAGCCA and TGTGGCGAATAGACAGAGGT) and Gli3 (GAACAGTGTGAGGAGAGACAG-CGAC and GAACTGACCTCGTTCCACTGGATG). Primers and competimers for 18s rRNA (Quantum mRNA 18s Internal Standards, Ambion, Austin, Tex) were also included to obtain 18s bands that were used to normalize the Gli bands. Amount of competimer was adjusted to obtain 18s bands of the similar magnitude as the Gli bands. PCR was carried out using annealing and extension temperatures of 60°C and 68°C for 30 seconds and 75 seconds, respectively. We determined the amount of PCR products, both Gli and 18s, developed through 32 cycles and demonstrated linear increases in product (not shown). Thus, for valid quantitative measurements, PCR reactions were carried out for 31 cycles. The intensity of the bands was measured using the Quantity One image system (Bio-Rad, Hercules, Calif). Controls for DNA contamination were included in each gel by either omitting the RT in the cDNA synthesis reaction or by omitting the template in the PCR reaction. Gels were stained with ethidium bromide.


Figure 1
View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. (A) Schematic representation of typical segmentation of the mouse epididymis. Segments 1–5/6 make up what is traditionally called the caput, with segment 1 being the so-called initial segment. Segments 6 and 7 make up the corpus, and segments 8–10 make up the cauda. (B) Shh expression values (mean ± SEM) in the 10 segments of the mouse epididymis. Low expression in proximal segments is followed by increasing expression distally. Histogram bars sharing the same superscript letters (a, b) are not significantly different (P < .05).

 
In a separate study, segments 1 and 2 together and segments 9 and 10 together were dissected from control epididymides (n = 5) by the techniques described above, and RNA from these tissues was similarly isolated. Expression of prostaglandin D2 synthase (Ptgds) in the 2 tissues was determined by sq-RT-PCR, as described above, using the following primers: AGCCCAACTTTCAACAAGAC (forward) and CACCTGCGTTTACTCTTGAA (reverse). In this case, amplification was carried out for 28 cycles using annealing and extension temperatures of 52°C and 68°C for 30 seconds and 75 seconds, respectively. This was done to confirm the low proximal and high distal expression of Ptgds seen in the microarray results.

In Vivo Micropuncture and Microassay for Sperm Motility

Epididymides of anesthetized animals (n = 5/group) were exteriorized and subjected to in vivo micropuncture of the distal cauda tubules (Figure 1A, segment 10) using techniques previously described (Turner, 1985; Turner and Bomgardner, 2002) but modified for the mouse. Briefly, the exposed cauda was viewed through a dissecting microscope and was micropunctured with a sharpened glass micropipette (50-µm tip opening) attached to a micromanipulator. Cauda content (approximately 100 nL/sample) was collected by applying carefully controlled negative pressure through a PE50 polyethylene cannula attached to a glass syringe and to the micropipette. The motility of cauda spermatozoa was determined using a microassay for sperm motility, as described previously for the rat (Turner and Howards, 1978; Turner and Giles, 1982; Turner and Reich, 1987) but modified for the mouse. Briefly, 1-µL volumes of 0.9% saline were deposited under mineral oil in both wells of 2-well culture slides maintained at 32°C. Duplicate aliquots of cauda content (50 nL each) were deposited directly from their collection pipette into the 2 saline drops under oil, and sperm motility in the samples was assessed in duplicate under 100x magnification using a 0–4 scoring system. Motility was scored in whole numbers only (0 = no motility, 4 = maximum perceived motility) beginning immediately (time 0) and continuing thereafter every 15 minutes for 2 hours. This qualitative assay for sperm motility has the benefits of allowing examination of motility immediately upon collection from the cauda lumen, it allows assessment of motility without contaminating factors from other fluid compartments, and it allows a standardized, although qualitative, assessment of sperm motility when those sperm can only be collected in extremely small volumes.

To assess whether cyclopamine in epididymal fluid was having a direct effect on sperm motility, cauda sperm were collected from control animals and diluted 1:20 in either saline alone, 1: 100 DMF:saline, or 1:100 DMF containing 0.27 µg cyclopamine:saline (for a final concentration of ~0.027 µg cyclopamine/mL diluent). Motility was assessed as described above.

Neither the clearance rate nor tissue distribution of cyclopamine is known for the mouse or any other species, although it is presumed to be quite rapid (Gaffield, personal communication); thus, estimates of intraepididymal cyclopamine concentrations had to be based on several broad assumptions regarding total body water, equivalent distribution of cyclopamine across all body compartments, and rapid clearance. These assumptions led to the calculated value of 0.027 µg cyclopamine/mL as the concentration of cyclopamine potentially in cauda lumen fluid during the period of cyclopamine administration via the osmotic minipumps.

Statistics

Two-group comparisons were by Student's t test or paired t test, as appropriate, and multiple comparisons were by analysis of variance followed by Tukey range test; {alpha} equals .05 in all cases.


   Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Microarray Analysis of Segmental Shh, Ptc1, Gli1, Gli2, and Gli3 Expression in the Mouse Epididymis

The 10 segments of the murine epididymis (Figure 1A) vary significantly in Shh expression (Figure 1B). Low expression in segment 1 is followed by increases in segments 2 and 3, and values reach their highest levels in segment 10 (Figure 1A). Ptc1 and Gli1 were detectable at low levels in all segments of the epididymis, but their expression was qualitatively lower than that of Shh (Ptc1 mean expression value {cong}85 and Gli1 mean expression {cong} 65; background = 50), but without significant pattern (results not shown). Gli3 expression was also without pattern between segments, but its average expression values were approximately 5 times those of Gli1 (mean {cong} 275). Gli2 expression was not detectable by microarray analysis of the mouse epididymal transcriptome; thus, no further work was done with this gene.


Figure 2
View larger version (58K):
[in this window]
[in a new window]
 
Figure 2. (A) Gli1 and Gli3 expressions in the control mouse epididymis detected by reverse transcriptase–polymerase chain reaction (RT-PCR). The right lane represents simultaneous amplification of Gli1 and Gli3 in the same sample, and the other 2 lanes illustrate individual amplifications from a different sample. Gli3 band density is more than twice that of Gli1 in both cases. (B) Semiquantitative RT-PCR analysis for Gli1 and Gli3 in control and cyclopamine-treated epididymides, duplicate illustrations of each. Two different primer sets were used to generate the 18s product (high or low) because of the varying size of the Gli products.

 
Effects of Cyclopamine Treatment on Gli1 and Gli3 Expression and on Cauda Epididymal Sperm Motility

Sample loss or collection failures at the end of the sham or cyclopamine treatment periods limited these sample numbers to 4 per group; nevertheless, sq-RT-PCR using RNA from the intact mouse epididymis demonstrated more Gli3 than Gli1 expression (Figure 2A), with Gli3 expression being over 2 times Gli1 expression. Gli1 expression in the mouse epididymis was reduced by an average of 61% after 14-day cyclopamine treatment (18s: Gli1 ratios in sham-treated epididymides averaged 5.34 ± 1.90 [mean ± SEM] and 2.1 ± 0.67 in cyclopamine-treated animals), and Gli3 expression was reduced by an average of 52% (18s:Gli3 ratios were 2.50 ± 0.12 in sham-treated epididymides and 1.21 ± 0.34 in cyclopamine-treated epididymides; Figure 2B).


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. (A) Mean (±SEM) motility scores of cauda epididymal sperm collected after 14-day treatment with cyclopamine ({blacktriangleup}) or sham treatment with vehicle alone ({blacksquare}) when diluted 1:20 in physiological saline. Sperm collected from unoperated controls and assayed in 1:20 in physiological saline ({diamondsuit}) did not exhibit motility different from sperm collected from animals under sham treatment. The cyclopamine treatment significantly reduced cauda sperm motility. (B) Mean (±SEM) motility scores of cauda epididymal sperm from unoperated control animals when cauda sperm were diluted in either physiological saline ({diamondsuit}), saline + 1% dimethylformamide (DMF; {blacksquare}), or saline/DMF + 0.027 µg cyclopamine/mL ({blacktriangleup}). Neither DMF nor cyclopamine had a direct effect on sperm motility.

 
Control mouse cauda sperm are immotile in undiluted cauda fluid (not shown), but they initiate vigorous, maximum perceived motility when diluted 1:20 in physiological saline (Figure 3A). Samples receiving the maximum motility score of 4 were seen as a swirling mass of vigorously motile cells, a quality of motility that continued for over an hour in sperm from both control and sham-infused epididymides. Cauda sperm collected from mice after 14 days of cyclopamine treatment exhibited a significant reduction in initial motility scores (2.0 ± 0.0) relative to those collected from control (4.0 ± 0.0) or sham-infused animals (4.0 ± 0.0; Figure 3A); thus, the ability of the sperm to initiate motility under assay conditions was compromised by cyclopamine treatment, but the duration of the motility exhibited was not altered.

In a separate experiment, control cauda sperm diluted 1:20 in saline, saline + DMF, or saline + DMF + 0.027 µg cyclopamine/mL did not exhibit any differences in either the initiation or duration of motility (Figure 3B).

The qualitative histology of the testes and epididymides of animals after 14-day cyclopamine exposure was identical to that of sham controls. Complete spermatogenesis appropriate to stage was ongoing in testes of both groups of animals. Johnsen scores (mean ± SEM) of testes from sham-infused and cyclopamine-infused animals were 4.86 ± 0.06 and 4.92 ± 0.04, respectively, reflecting completely normal spermatogenesis. There were sperm in the epididymal lumena of all animals, and the tubule epithelia in the various segments appeared completely normal. Measured epididymal epithelial heights (mean ± SEM) in segments 1 and 2 of sham-infused and cyclopamine-infused animals were 44.5 ± 0.9 µm, 27.2 ± 0.7 µm, 45.2 ± 1.1 µm, and 26.5 ± 0.9 µm, respectively.

Cluster Analysis for Potential Gene Targets of the Shh Pathway

Cluster analysis for Shh gene expression was performed to determine which genes are expressed in the mouse epididymis in a segmental pattern similar to Shh. This analysis was performed at both the 95% and the 93% confidence limits using the data set from the mouse epididymal transcriptome generated by our lab (Johnston et al, 2005). At the 95% confidence limits, 2 known genes are expressed in a pattern similar to Shh: SET and MYND domain containing 2 (Smyd2) and Ptgds. At the 93% confidence limits, another 7 known genes were expressed in a pattern similar to Shh. These were DAZ-associated protein 2 (Dazap2), cytoskeletal-associated protein 4 (Ckap4), nuclear factor, erythroid-derived 2 (Nfe212), dipeptidylpeptidase 4 (Dpp4), pre-B cell leukemia transcription factor 1 (Pbx1), PCTAIRE-motif protein kinase 1 (Pctk1), and N-myristoyltransferase 2 (Nmt2). Gene expression values of Ptgds were particularly robust and followed the pattern of Shh very closely (Figure 4A and B). Expression of Ckap4, as an example from the 93% confidence group, was typical of the genes more modestly expressed than Shh and which followed the Shh pattern less closely (Figure 4C). All of the genes in these clusters rose rapidly in expression through segments 1–3 and 4, then either declined or stayed flat through segments 5–8 and increased again in segments 9–10 or 10 alone, but none followed the pattern of Shh more closely than Ptgds.


Figure 4
View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Expression values (mean ± SEM) of selected genes having similar expression profiles through the mouse epididymis. Shh expression (A) was closely mimicked by Pg2s (B), a gene clustering with Shh at a 95% confidence level, but gene expressions like Ckap4 (C), which clustered with Shh at a 93% confidence level, showed a relatively less clear similarity.

 
The differential expression pattern of Ptgds in the mouse epididymis was validated generally by sq-RT-PCR of RNA from combined segments 1 and 2 vs combined segments 9 and 10 (Figure 5). These specific segments were chosen because microarray results showed them to be sites of relatively low and high Ptgds expression, respectively. The sq-RT-PCR results confirmed that Ptgds expression increases from the segments of the proximal caput to the segments of the distal cauda. The band densities relative to 18s in the segment 1 and 2 samples of Figure 5 were only 6.5% of the band densities relative to 18s in segments 9 and 10.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Prostaglandin D2 synthase (Ptgds) gene expression in segments 1 and 2 vs segments 9 and 10 in the mouse epididymis. Duplicate RNA samples (+) extracted from segments 1 and 2 and segments 9 and 10 were used in semiquantitative reverse transcriptase–polymerase chain reaction (RT-PCR) for Ptgds and illustrate that the gene is more highly expressed in the distal segments than in the proximal segments. This is consistent with the results of the microarray analysis of Ptgds expression in all 10 segments of the mouse epididymis (Figure 4B). No RT lanes (-) were negative for PCR product, nor were no-template lanes (not shown).

 


   Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Shh is a well-characterized member of the vertebrate Hh family with known functions as both a short-range, contact-dependent signaling molecule and as a long-range, diffusible morphogen during development (Villavicencio et al, 2000; Nybakken and Perrimon, 2002). The molecule is one of a number of molecules important in segmental or other pattern development in the embryo and is well known for its role in the development of the prostate (Podlasek et al, 1999; Lamm et al, 2002) and external genitalia (Perriton et al, 2002). Because the epididymis is maintained as a highly segmented organ in adulthood, we recently examined for Shh expression in the adult mouse epididymis. Shh was detectable in the epididymis at both the gene and protein level and was expressed in a regionally differential pattern, increasing distally (Turner et al, 2004). Shh expression was also increased in the proximal epididymis in a time-dependent manner after efferent duct ligation, implying that the gene was regulatable (Turner et al, 2004). These results raised the question of whether the Shh pathway is important for adult epididymal function.

An important aspect of epididymal function is the ability to maintain a luminal microenvironment conducive to the maturation of sperm, and one measure of sperm maturity is their capacity for motility after transit through the epididymis. Immature sperm swim poorly or not at all, and mature sperm express a high degree of progressive motility (Turner and Howards, 1978; Yeung and Cooper, 2002). In the present work we have administered the Shh pathway inhibitor cyclopamine for a period long enough to have allowed mouse cauda sperm to make their complete epididymal transit in an epididymis with an inhibited Shh pathway. At that time we assessed cauda sperm for the ability to initiate and maintain motility, and we assayed epididymal RNA for evidence that the Shh pathway had, indeed, been inhibited.

First, microarray results from all 10 epididymal segments confirmed the overall Shh expression pattern previously reported for 3 regions: caput, corpus, and cauda (Turner et al, 2004; ie, Shh expression increases distally) (Figure 1). The microarray results gave more detail to the expression pattern than was known previously and allowed subsequent cluster analysis for genes of similar expression patterns (see below). Also, the microarray analysis of epididymal gene expression showed that, similar to our previous results using sq-RT-PCR (Turner et al, 2004), Gli1 expression does not change significantly along the length of the mouse epididymis. Interestingly, however, the microarray analysis demonstrated that Gli3 expression levels were much higher than those of Gli1, although again, there was no discernable pattern of expression across the epididymal segments. Because of its relatively high expression upon microarray analysis, Gli3 was included in the subsequent investigation.

Gli1 is a positive-regulating transcription factor of the Shh signaling pathway and is induced by Shh in a number of tissues (Marigo et al, 1996; Dahmane et al, 1997; Lee et al, 1997); thus, in the present study, Gli1 expression was used as a marker for cyclopamine effects on the Shh pathway. Gli activities are complex, however, and not all Gli's respond or act similarly. Gli3, for example, is reportedly repressed, not induced, by Shh during development and is a repressor rather than an inducer of gene transcription (Ruiz-Altaba, 1999). On the other hand, in NIH3T3 cells, Gli3 binds to the Gli1 promoter and induces Gli1 transcription in response to Shh (Dai et al, 1999). Further, in zebrafish, Gli3 acts as both an activator and a repressor (Tyurina et al, 2005). These findings made it difficult to predict what result Shh pathway inhibition would have on Gli3 transcription, but the gene was included in our study for the reasons stated above.

Sq-RT-PCR for Gli1 and Gli3 validated the microarray results (ie, Gli3 is more highly expressed in the mouse epididymis than Gli1) (Figure 2A). Further, cyclopamine treatment for 2 weeks reduced expression of Gli1 by more than half (Figure 2B) in the absence of any change in testis morphology, indicating that the cyclopamine treatment produced an inhibition of the Shh pathway, as it had previously (Van Den Brink et al, 2001), and without significant change to the animals' endocrine status. The treatment also reduced Gli3 expression (Figure 2B), indicating that the regulation of this gene in the adult may also be dependent on the ligation of Ptc1 to Shh. The cyclopamine treatment did not change epididymal morphology, thus indicating that the changes in the epithelium did not involve morphology, but perhaps a more subtle secretory or metabolic process.

It would have been interesting to know the regional or even segmental responses of the epididymis to cyclopamine treatment vis-à-vis Gli expressions, but intact epididymides were used for this part of the study for reasons of simplicity and economy. The information gained was sufficient to determine that cyclopamine did, in fact, inhibit epididymal Gli expression. Further, the lack of any effect of cyclopamine on testicular or epididymal size or histology implies there was no biologically significant effect on testicular or pituitary hormones.

Inhibition of the Shh pathway during epididymal transit was associated with a reduction in the capacity of cauda sperm to initiate motility when diluted 1:20 in assay diluents (Figure 3A). That this was not a direct effect of cyclopamine on cauda sperm is indicated by the absence of effect of cyclopamine when added directly to the sperm diluent (Figure 3B). This was an acute exposure, however, and it is recognized that this does not absolutely rule out the possibility that long-term exposure of sperm to small amounts of cyclopamine in the epididymal fluid might affect the expression of motility. There is no evidence to indicate that this might be so, nor is there a known mechanism by which it might occur.

The finding that an uninhibited Shh pathway in the epididymis is important for the development of sperm motility is novel and raises the question of gene targets for the pathway in the epididymis. In embryonic tissues, Shh signaling has been shown to have a variety of Fgf, Bmp, Wnt, and Pax genes as targets (Christ et al, 1998; Perriton et al, 2002; Scherz et al, 2004), but no genes in these families were detected as co-expressors with Shh in the adult mouse epididymis. Rather, the known genes with expression patterns closest to that of Shh (95% confidence level) were Ptgds and Smyd2. Smyd2 is a gene of unknown function and is poorly expressed (expression values 40–140), whereas Ptgds is known to be a prominently synthesized and secreted protein in the epididymis of other species (Turner et al, 2000; Dacheux et al, 2003), and Ptgds was highly expressed in the distal segments of the mouse epididymis, whether assessed by microarray analysis (Figure 4) or sq-RT-PCR (Figure 5). The utility of this secreted protein in the epididymal lumen remains unknown, although its absence in bull seminal plasma is associated with infertility (Gerena et al, 1998). These associations make Ptgds a potential target of the Shh pathway and an interesting target for further investigation.

We recognize that the fidelity of a gene's expression pattern with that of a signal molecule is not a guarantee of a signal-target relationship. Neither is the level of gene expression necessarily an indicator of the importance of the gene product; therefore, the other genes highlighted in our cluster analysis at both the 95% and 93% level of confidence will remain as candidate target genes of the Shh pathway in the mouse epididymis.

It is interesting that in neither the present study nor that conducted previously using a different assay (Turner et al, 2004) have Ptc1 and Gli1 followed the Shh expression pattern, yet when the Shh pathway is inhibited with cyclopamine, Gli expressions decline. It could be that some threshold level of Smo activation is required to maintain rather tonic Gli expression levels across the epididymal segments, but failing that Smo activation, Gli expressions are reduced.


   Acknowledgments
 
The authors express their thanks to Dr Scott Jelensky for his excellent leadership of the Molecular Profiling Core, Wyeth Research, which performed the microarray analysis used in this project. The assistance of Sanja Usanovic with several aspects of this project is also gratefully acknowledged.


   Footnotes
 
Supported by National Institutes of Health (NIH) grant P50 DK45179, NIH grant T32 HD07382, and Wyeth Research.


   References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Bitgood MJ, Shen L, McMahon AP. Sertoli cell signaling by desert hedgehog regulates the male germline. Curr Biol. 1996; 6: 298 -304.[CrossRef][Medline]

Bomgardner D, Hinton BT, Turner TT. Hox transcription factors may play a role in regulating segmental function of the adult epididymis. J Androl. 2001;22: 527 -531.[Medline]

Chen JK, Taipale J, Cooper MK, Beachy PA. Inhibition of Hedgehog signaling by direct binding of cyclopamine to Smoothened. Genes Dev. 2002;16: 2743 -2748.[Abstract/Free Full Text]

Christ B, Schmidt C, Huqang R, Wilting J, Brand-Saberi B. Segmentation of the vertebrate body. Anat Embryol. 1998; 197: 1 -8.[Medline]

Dacheux JL, Gatti JL, Castella S, Metayer S, Fouchecourt S, Dacheux F. The epididymal proteome. In: Hinton BT, Turner TT, eds. The Third International Conference on the Epididymis. Charlottesville, Va: The Van Doren Company; 2003: 115 -122.

Dahmane N, Lee J, Robins P, Ruiz-Altaba A. Activation of the transcription factor Gli1 and the sonic hedgehog signaling pathway in skin tumors. Nature. 1997; 389: 876 -891.[CrossRef][Medline]

Dai P, Akimaru H, Tanaka Y, Maekawa T, Nakafuku M, Ishii S. Sonic hedgehog–induced activation of the Gli1 promoter is mediated by GLI3. J Biol Chem. 1999; 274: 8143 -8152.[Abstract/Free Full Text]

Gerena RL, Irikura D, Urade N, Eguhi N, Chapman DA, Killian GJ. Identification of the fertility associated protein in bull seminal plasma as lipocalin-type, prostaglandin D2 synthase. Biol Reprod. 1998;58: 826 -833.[Abstract/Free Full Text]

Hammerschmidt M, Brook A, McMahon AP. The world according to hedgehog. Trends Genet. 1997; 13: 14 -21.[CrossRef][Medline]

Ingham PW, McMahon AP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev. 2001; 15: 3059 -3087.[Free Full Text]

Johnsen SG. Testicular biopsy score count—a method for registration of spermatogenesis in human testes: normal values and results in 335 hypogonadal males. Hormones. 1970; 1: 2 -25.[Medline]

Johnston DS, Jelinsky SA, Bang HJ, DiCandeloro P, Wilson E, Kopf GA, Turner TT. The murine epididymal transcriptome: transcriptional profiling of segmental gene expression in the epididymis. Biol Reprod. 2005;73: 404 -413.[Abstract/Free Full Text]

Keeler RF, Baker DC. Oral, osmotic minipump, and intramuscular administration to sheep of the Veratum alkaloid, cyclopamine. Proc Soc Exp Biol Med. 1989; 192: 153 -156.[CrossRef][Medline]

Kirchhoff C. Gene expression in the epididymis. Int Rev Cytol. 1999;188: 133 -202.[Medline]

Lamm MLG, Catbagan WS, Laciak RJ, Barnett DH, Hebner CM, Gaffield W, Walterhouse D, Iannaccone P, Bushman W. Sonic hedgehog activates mesenchymal Gli1 expression during prostate ductal bud formation. Dev Biol. 2002; 249: 349 -366.[CrossRef][Medline]

Lee J, Platt KA, Censullo P, Ruiz-Altaba A. Gli1 is a target of Sonic hedgehog that induces ventral neural tube development. Development. 1997; 124: 2537 -2552.[Abstract]

Marigo V, Johnson RL, Vortkamp A, Tabin CJ. Sonic hedgehog differentially regulates expression of GLI1 and GLI3 during limb development. Dev Biol. 1996; 180: 273 -283.[CrossRef][Medline]

Nybakken K, Perrimon N. Hedgehog signal transduction: recent findings. Curr Opin Gene Dev. 2002; 12: 503 -511.[CrossRef][Medline]

Perriton CL, Powles N, Chiang C, Maconochie MK, Cohn MJ. Sonic hedgehog signaling from the urethral epithelium controls external genital development. Dev Biol. 2002; 247: 26 -46.[CrossRef][Medline]

Podlasek CA, Barnett DH, Clemens JQ, Bak PM, Bushman W. Prostate development requires Sonic hedgehog expressed by the urogenital sinus epithelium. Dev Biol. 1999; 209: 28 -39.[CrossRef][Medline]

Ruiz-Altaba A. Gli proteins and hedgehog signaling. Trend Genet. 1999; 15 : 418-425.[CrossRef][Medline]

Scherz PH, Harfe BD, McMahon AP, Tabin CJ. The limb bud Shh-Fgf feedback loop is terminated by expansion of former ZPA cells. Science. 2004;305: 396 -399.[Abstract/Free Full Text]

Turner TT. Transepithelial movement of 3H-androgen in seminiferous and epididymal tubules: a study using in vivo micropuncture and in vivo microperfusion. Biol Reprod. 1985; 39: 399 -408.

Turner TT, Bomgardner D. On the regulation of Crisp-1 mRNA expression and protein secretion by luminal factors presented in vivo by microperfusion of the rat proximal caput epididymidis. Mol Reprod Dev. 2002;61: 437 -444.[CrossRef][Medline]

Turner TT, Bomgardner DA, Jacobs JP. Sonic hedgehog pathway genes are expressed and transcribed in the adult mouse epididymis. J Androl. 2004;25: 514 -522.[Abstract/Free Full Text]

Turner TT, Bomgardner D, Jacobs JP, and Nguyen QAT. Association of segmentation of the epididymal interstitium with segmented tubule function in rats and mice. Reproduction. 2003; 125: 871 -878.[Abstract]

Turner TT, Giles RD. The effects of cyclic adenine nucleotides, phosphodiesterase inhibitors, and cauda epididymidal fluid on the motility of rat epididymal spermatozoa. J Androl. 1982; 3: 134 -139.[Abstract]

Turner TT, Howards SS. Factors involved in the initiation of sperm motility. Biol Reprod. 1978; 18: 571 -578.[Abstract]

Turner TT, Reich GW. Influence of proteins in the rat cauda epididymal lumen fluid on cauda sperm motility. Gamete Res. 1987;18: 267 -278.[Medline]

Turner TT, Riley TA, Vagnetti M, Flickinger CA, Caldwell JA, Hunt DF. Post-vasectomy alterations in protein synthesis and secretion in the rat caput epididymidis are not repaired after vasovasostomy. J Androl. 2000;2: 276 -290.

Tyurina OV, Popova GB, Feng E, Schier J, Kohtz AF, Karlstrom RO. Zebrafish Gli3 functions as both an activator and a repressor in Hedgehog signaling. Dev Biol. 2005; 277: 537 -556.[CrossRef][Medline]

Van Den Brink GR, Hardwick JCH, Tytgat GNJ, Brink MA, Ten Kate PJ, Van Deventer SJH, Peppelenbosch MP. Sonic hedgehog regulates gastric gland morphogenesis in man and mouse. Gastroenterology. 2001; 121: 317 -328.[CrossRef][Medline]

Villavicencio EH, Walterhouse DO, Iannaccone PM. The sonic hedgehog-patched-gli pathway in human development and disease. Am J Hum Genet. 2000;67: 1047 -1054.[Medline]

Yeung CH, Cooper TG. Acquisition and development of sperm motility upon maturation in the epididymis. In: Robaire B, Hinton BT, eds. The Epididymis From Molecules to Clinical Practice. New York, NY: Kluwer Academic/Plenum Publishers; 2002: 417 -434.

Yongbing P, Huang L, Prins GS. Sonic hedgehog-patched-Gli signaling in the developing rat prostate gland: lobe-specific suppression by neonatal estrogens reduces ductal growth and branching. Dev Biol. 2004; 273: 257 -275.[CrossRef][Medline]




This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
G. A. Cornwall
New insights into epididymal biology and function
Hum. Reprod. Update, March 1, 2009; 15(2): 213 - 227.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
R. J. Lipinski, P. R. Hutson, P. W. Hannam, R. J. Nydza, I. M. Washington, R. W. Moore, G. G. Girdaukas, R. E. Peterson, and W. Bushman
Dose- and Route-Dependent Teratogenicity, Toxicity, and Pharmacokinetic Profiles of the Hedgehog Signaling Antagonist Cyclopamine in the Mouse
Toxicol. Sci., July 1, 2008; 104(1): 189 - 197.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
T. T. Turner
De Graaf's Thread: The Human Epididymis
J Androl, May 1, 2008; 29(3): 237 - 250.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. L. Tomsig, S. Usanovic, and T. T. Turner
Growth Factor-Stimulated Mitogen-Activated Kinase (MAPK) Phosphorylation in the Rat Epididymis Is Limited by Segmental Boundaries
Biol Reprod, October 1, 2006; 75(4): 598 - 604.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
J. L. Tomsig and T. T. Turner
Growth Factors and the Epididymis
J Androl, May 1, 2006; 27(3): 348 - 357.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
27/2/225    most recent
Author Manuscript (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Turner, T. T.
Right arrow Articles by Tomsig, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Turner, T. T.
Right arrow Articles by Tomsig, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS