| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the * Department of Pharmacology, Israel
Institute for Biological Research, Ness Ziona, Israel; the
Center for Biomedical Research, Population
Council and the Rockefeller University, New York, New York; and the
Department of Cell Biology and Biochemistry,
Texas Tech University Health Sciences Center, Lubbock, Texas.
| Correspondence to: Dr B. A. Weissman, Department of Pharmacology, Israel Institute for Biological Research, PO Box 19, Ness Ziona 74100, Israel (e-mail: baw{at}iibr.gov.il). |
| Received for publication November 19, 2004; accepted for publication January 5, 2005. |
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Key words: Macrophage, testosterone, DNA gene array, nitric oxide synthase, S-nitrosoglutathione, L-NG-nitro-arginine methyl ester, L-NG-monomethyl-arginine
Macrophages are potent secretory cells that release an array of mediators, including proinflammatory and cytotoxic cytokines (Hales, 1996; Hutson, 1998). When stimulated with agents such as lipopolysaccharide (LPS), these cells express inducible NOS (iNOS) and release NO (Di Rosa et al, 1990). Since testicular macrophages reside in close proximity to Leydig cells in the interstitial tissue (Hutson, 1992), they have been hypothesized to act as a source of NO, thereby modulating Leydig cell steroidogenesis under conditions of immune activation. In fact, testicular (Sun et al, 1993) or peritoneal macrophages (Pomerantz and Pitelka, 1998) depressed androgen biosynthesis when studied under in vitro conditions that mimic this immune-activated state. It is hypothesized that NO mediates this suppression, since L-nitro-L-arginine methyl ester (an NOS inhibitor) prevented this macrophage-mediated inhibition of steroidogenesis (Pomerantz and Pitelka, 1998).
In the present study, we examined whether rat Leydig cells have the capacity to generate NO and, if so, whether the amounts of NO generated locally in the testis are sufficient to inhibit T production. Data presented herein indicate that in purified rat Leydig cells, exogenously supplied NO potently abolishes T production. Nevertheless, the endogenous NOS substrate (ie, L-arginine) or NOS inhibitors (eg, L-NG-nitro-arginine methyl ester [L-NAME]) failed to modify NO generation or androgen biosynthesis. Moreover, DNA array assays clearly showed that adult rat Leydig cells do not express iNOS or neuronal NOS (nNOS), and only a marginal quantity of the endothelial isoform of NOS (eNOS) could be detected. Reverse transcriptase-polymerase chain reaction (RT-PCR) analyses confirmed these observations by demonstrating that messenger RNA (mRNA) expression of NOS isoforms is below the detection level. This technique, combined with measurements of NO generation, showed that LPS-stimulated testicular macrophages express iNOS and produce NO. Thus, to the extent that NO is locally produced in the testis, testicular macrophages are the best candidate to modulate Leydig cell T production through paracrine NO signaling.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Animals
Male Sprague-Dawley rats (250–300 g; Charles River Laboratories,
Wilmington, Mass) were maintained under conditions of controlled lighting
(lights on from 0700–1900 hours) and temperature (23°C) and were
allowed free access to food. Testes were removed after asphyxiation with
CO2 in a precharged chamber, in accordance with a procedure that
was approved by Rockefeller University's Animal Care and Use Committee
(protocol 03-048).
Leydig Cell T Production
Purified Leydig cells were prepared as previously described
(Klinefelter et al, 1993).
Briefly, testes were subjected to collagenase digestion and, before loading
onto a 55% continuous Percoll density gradient, the cell suspension was
subjected to centrifugal elutriation to remove germ cell and sperm
contaminants. The fraction of Leydig cells remaining in the elutriator chamber
at a flow rate greater than 16 mL/min and a rotor speed of 800 x
g was collected. Leydig cells were harvested from the Percoll
gradient at densities of 1.070 g/mL and greater. The cells were counted using
a hemacytometer, and purity was determined by histochemical staining for
3ß-hydroxysteroid dehydrogenase (3ß-HSD)
(Payne et al, 1980) and was
typically 95% to 97%. The amounts of T produced by Leydig cells were measured
after incubation for 1 hour in 1 mL of 1:1 DMEM:F-12 culture medium containing
0.1% bovine serum albumin (BSA) and 0.5 mg of bovine lipoprotein per
milliliter and were buffered with 14 mM NaHCO3. T production was
expressed as nanograms of steroid per 106 cells/h.
Testicular Macrophages
Testicular macrophages were isolated from rats as previously described
(Hutson et al, 1996;
Nes et al, 2000). Briefly,
testes were perfused through the gonadal vein with collagenase (100 U/mL) in
medium (DME/F-12 plus 0.1% BSA, penicillin [100 U/mL], and streptomycin [100
µg/mL]). The testes were then decapsulated and further digested in
collagenase in a shaking water bath. Undigested seminiferous tubules were
removed, and the interstitial cells were recovered from the supernatant by
centrifugation (350 x g, 6 minutes). Interstitial cells were
suspended in the medium and plated into 35-mm culture dishes for 10 to 15
minutes to allow rapidly adhering macrophages to attach. Nonadherent cells
were then removed by vigorous washing with the medium. Cells were maintained
in 1 mL of medium at 34°C in a humidified atmosphere of 95% air and 5%
CO2. Testicular macrophages isolated in this manner are
approximately 95% positive for Fc receptor. For experiments involving NO
production, testicular macrophages were separated without applying
collagenase, as previously described
(Moore and Hutson, 1994).
Testicular macrophages were plated into 35-mm dishes at a range of 45 000 to 300 000 cells/dish. After 1 to 2 hours in culture, cells were treated for 24 hours with LPS (0.1 or 10.0 µg/mL) in 1 or 2 mL of medium containing 0.2% BSA.
Tissue Preparation
Rat skeletal muscle (forelimb, ca 0.4 g) was frozen in liquid nitrogen, and
the powder obtained was homogenized in 5 mL of homogenization buffer (1 mM
EDTA, 1 mM EGTA, 25 mM Tris-HCl, pH 7.4) and centrifuged at 4°C for 60
minutes at 100 000 x g. NOS activity in cytosol and the
membrane fractions was examined as described by Kobzik et al
(1994).
Determination of L-[14C]Citrulline Formation in Cultured Leydig Cells
Purified Leydig cells from 3 to 6 rats (106 cells/tube) were
washed with phosphate-buffered saline (PBS) and incubated for 30 minutes at
34°C in the presence of 5 x 105 cpm
L-[14C]arginine as described by Wang et al
(1997). Cells were then
exposed for 20 minutes to ionomycin (5 µM) in the presence or absence of LH
(100 ng/mL). Following an extensive wash with 4 mL of PBS containing 5 mM
EDTA, cells were homogenized and centrifuged for 10 minutes at 12 000 x
g, and L-[14C]citrulline in the supernatants
was estimated by ion-exchange chromatography on Dowex AG 50X-8 columns
(Na+ form) and liquid scintillation spectroscopy as described by
Wang et al (1997). T
biosynthesis in Leydig cells exposed to ionomycin was estimated by
radioimmunoassay after 2 hours of incubation as described below.
NOS Activity
The activity of NOS in the homogenates of rat Leydig cells was determined
by assessing the conversion of L-[14C]arginine to
L-[14C]citrulline according to a previously reported
procedure (Weissman and Gross,
1998). Leydig cells purified from 3 to 6 rats were centrifuged at
1000 x g for 10 minutes at 4°C, resuspended in PBS, and
centrifuged again. The final pellet from 10 x 106 cells was
homogenized in 100 µL of homogenization buffer by a 2 x 10-second
sonication (20% maximum energy) using an ultrasonic homogenizer (Cole Parmer
Instruments, Chicago, Ill), which was followed by 5 minutes of centrifugation
at 1000 x g. Supernatants (ie, the cytosolic fraction) and
resuspended pellets (ie, the plasma membrane) were then incubated in duplicate
tubes at 34°C in reaction buffer (3 µM tetrahydrobiopterin [BH4], 1
µM flavin adenine dinucleotide, and 1 µM flavin mononucleotide) to which
0.1 µM of calmodulin and approximately 0.5 µCi of
L-[14C]arginine were added. Reaction tubes contained
samples with a protein content equivalent to 106 cells, and
incubations were terminated by the addition of 1 mL of stop buffer (5 mM EDTA,
50 mM HEPES, pH 5.5). L-[14C]citrulline was separated by
ion-exchange chromatography and estimated by liquid scintillation
counting.
T Radioimmunoassay
T production by Leydig cells was measured with a tritium-based
radioimmunoassay as described previously, with a 7% to 8% interassay variation
(Cochran et al, 1981).
S-nitrosoglutathione Preparation
S-nitrosoglutathione (GSNO) was prepared as previously described
by Mallis et al (2001) and was
used immediately thereafter. Briefly, equal volumes of 220 mM of reduced
glutathione (GSH, dissolved in 1 M HCl) and 220 mM of sodium nitrite were
mixed and incubated in the dark at room temperature for 10 minutes. The
solution was then neutralized with NaOH to give a final concentration of
approximately 100 mM of GSNO. During these procedures, the mixture should be
kept on ice and protected from light. The precise concentration was calculated
from absorbance at 334 nm using an extinction coefficient of 767
M-1 cm-1.
DNA Array Assay
Preparation of RNA—
Four pools of Leydig cells were used for RNA extraction and for the DNA
analysis. For array analysis, RNA samples were processed according to the
Altas gene protocol (Clontech). Total RNA was extracted from isolated Leydig
cells by a single-step method, using phenol and guanidinium thiocyanate,
according to the manufacturer's instructions. The purity of isolated mRNAs was
evaluated spectrophotometrically, using the A260/A280 ratio. To reduce
contamination by genomic DNA, total RNA was treated with ribonuclease-free
deoxyribonuclease I for 1 hour at 37°C, followed by phenol/chloroform
extraction. The RNA was then purified by digestion with DNase I to eliminate
DNA contamination. The Leydig cell total RNA (400 ng) was reverse transcribed
with avian myeloblastosis virus RT in the presence of random hexamer plus
deoxynucleotide triphosphates (dNTPs) at 42°C for 75 minutes, and the
reaction was terminated by heating at 95°C for 5 minutes.
Probe Preparation and Hybridization
RNA samples of Leydig cells were used for hybridization to oligonucleotide
arrays corresponding to approximately 1185 known genes. To generate
reproducible gene expression data, 4 independent replicates of the Leydig cell
samples were analyzed. To generate radiolabeled complementary DNA (cDNA)
probes, total RNA was reverse transcribed with Moloney murine leukemia
virus-reverse transcriptase (MMLV-RT) and radiolabeled with
[32P]dATP (10 µCi/µL; Amersham Pharmacia Biotech). The
radiolabeled cDNA probes were purified from unincorporated nucleotides by gel
filtration on a Chroma Spin-200 column (Clontech) and hybridized overnight at
68°C to a rat microarray consisting of 1185 known rat genes, as described
by the manufacturer (Clontech).
Phosphor-imaging— After a series of stringent washes (three 20-minute washes in 2x saline sodium citrate [SSC]/1% sodium dodecyl sulfate [SDS], followed by two 20-minute washes in 0.1x SSC/0.5% SDS) at 68°C, the membranes were sealed in plastic (Kapak Corp, Minneapolis, Minn) and exposed to phosphor-imager plates for 3 to 48 hours. Images of the hybridized filters were obtained after scanning the plates (Storm, Molecular Dynamics Inc, Sunnyvale, Calif).
Image Analysis
The image intensity of each cDNA was imported into Atlas-Image software
(version 2.01, Clontech). The intensity of each spot, reflecting the relative
abundance of mRNA in the sample, was analyzed in 12 different membranes.
Individual gene intensities were normalized to an internal control
(housekeeping genes), ß-actin, and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH). All data collected were exported into ASCII files and
then imported into a relational database (Microsoft Access 2000), which was
designated as a Leydig Cell Array Database. In the Leydig Cell Array Database,
a bioinformatic listing for each gene was available via links from the
accession numbers, Locus Link, and Swissprot Accession.
RT-PCR Analysis
Two hundred fifty nanograms of total RNA was reverse transcribed (MMLV-RT;
Promega) in a total volume of 20 µL at 42°C for 75 minutes; then,
heating at 95°C for 5 minutes terminated the reaction. PCR amplification
was performed in a final volume of 25 µL to which 2 µL of cDNA had been
added. The reaction was performed on a PTC-100 thermal controller (MJ
Research, Boston, Mass), using the following sequences: TCATCA AGAAGG GAAAAG
AA and TGAAGC AGATAG CACAGA TG (17
-hydroxylase), GACATTGAGATCAAAGGACTGC
and CGGCTCGTCACCTCCTGG (eNOS), AATAGAGGAACATCTGGCCAGG and ACTTCCTCCAGGATGTTGTA
(iNOS), and GGTTGTCATCCCTCAGCCTGC and GGCAACAGCGACAATTTG (nNOS). The
conditions for denaturation, annealing, and extension were 95°C for 15
minutes, 55°C for 30 minutes, and 72°C for 45 minutes, respectively.
Assays were conducted at least 4 times for each gene. Densitometric signals
from individual bands were divided by the respective density for rat ribosomal
protein S16 to correct for differences in gel loading using an imaging system
(Kodak Digital Science, Rochester, NY).
Nitrite Determination
The concentration of nitrite that had accumulated in Leydig cells and
testicular macrophage culture media was measured by the Griess method (20).
Briefly, 100 µL of cell-free supernatants was mixed with 100 µL of
Griess reagent (1 part 1% sulfanilamide and 1 part 0.1%
naphthyl-ethylenediamine in 5% phosphoric acid solution) in 96-well microtiter
plates and incubated at room temperature for 5 minutes. After the incubation,
the absorbency of the wells was determined using a microtiter plate reader
(BioRad Labs, Kaloon, Hong Kong) equipped with a 540-nm filter. Concentrations
of nitrite were determined on the basis of standards of sodium nitrite in the
range of 0 to 60 µM dissolved in H2O and expressed as micromolar
concentrations of nitrite released per 3 x 105 cells per 24
hours.
Cell Viability— Leydig cell viability was estimated using the Trypan blue dye exclusion test. The stain (5 mg/mL) was added to the cell suspension for 5 minutes at a 1:5 dilution. Dead cells were stained blue. The number of cells excluding the Trypan blue dye was counted in a hemacytometer, and cell viability was the number of unstained divided by the total of stained plus unstained, expressed as a percentage.
Protein Determination
Protein concentrations were determined by the Bradford method
(Bradford, 1976), using BSA as
a standard.
Data Calculation and Statistical Analysis
T-production parameters were assessed by computer-assisted nonlinear
least-square regression analysis using the Prism4 program (GraphPad Software
Inc, San Diego, Calif). All data were analyzed by a 1-way analysis of
variance, with multiple comparisons performed by the Duncan multiple range
test to identify differences between groups. Differences were considered
significant at P < .05.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
In another set of experiments, freshly isolated rat Leydig cells were incubated in an arginine-free medium and in the presence of L-[14C]arginine. Following the initial period in which radioactive arginine was taken up, stimulation of T production by LH (100 ng/mL) or a robust increase in intracellular Ca2+ concentration due to the action of the calcium ionophore ionomycin (5 µM) did not affect L-[14C]citrulline levels. Under these conditions, rat Leydig cells were less sensitive to LH, as registered by their rates of T production: 6.56 ± 0.18, basal, vs 12.31 ± 0.47 ng/106 cells/h, LH-stimulated (n = 3). Additionally, this concentration of ionomycin had no effect on T production (data not shown). In a separate experiment, a comparison of the capacity of testis homogenates and Leydig cells to support the conversion of L-arginine to L-citrulline yielded rates of 356 and 95 fmol/min/mg of protein/min, respectively. These results indicate that most of the (low) NOS enzymatic activity in testes does not copurify with Leydig cells.
The commonly used calcium chelator EGTA (5 mM, Table 1) and the NOS inhibitor L-NAME (1 mM) failed to significantly affect the rate of L-citrulline formation in Leydig cell homogenates (data not shown). Under the same conditions, these agents potently inhibited NOS activity in homogenates prepared from rat cerebellum. EGTA and L-NAME produced 96% (n = 3) and 99% (n = 3, Table 1), respectively, inhibition of L-citrulline production in samples of cerebellum.
Modulation of T Production in Leydig Cells
LH induced a concentration-dependent elevation of T production by purified
rat Leydig cells with a median effective concentration (EC50) value
of 0.67 ng/mL (Figure 1). The
fivefold stimulation observed at this LH concentration is in the same range as
that reported by Payne et al
(1982) for Leydig cells
isolated from Sprague-Dawley rats. On the basis of this observation, a
concentration of 0.5 ng/mL was used throughout this study.
|
The addition of the NO donor GSNO (0.01 mM) to the incubation media of Leydig cells resulted in a potent inhibition of basal T production by approximately 70% (from 11.49 ± 4.2 to 3.02 ± 0.9 ng/106 cells/h, n = 9). This blockade of LH-stimulated steroidogenesis by GSNO was concentration dependent, could be detected at concentrations below 1 µM, and exhibited a concentration that inhibits 50% (IC50) value of 4.3 ± 1.5 µM (Figure 2). To exclude the possibility that changes in T production result from cell injury caused by NO, we examined the effects of GSNO on Leydig cell survival. As noted by others (eg, (Eizirik et al, 1996), the Trypan blue test showed an 86.05% ± 1.47% viability in control incubations (n = 6) compared to an 82.87% ± 1.34% viability in the presence of 0.1 mM of GSNO, a concentration that induced a complete inhibition of LH-evoked T production (n = 3). Under similar conditions, the survival rate of Leydig cells exposed to 0.01 mM of GSNO was 87.03% ± 1.92% (n = 5). Therefore, the inhibitory effects of NO on T production were not attributable to cytotoxicity.
|
In a representative experiment repeated with similar results 3 times, basal T production in L-arginine–free Leydig cell medium (LCMA) was 8.98 ± 2.9 ng/106 cells/h (n = 3). The addition of 0.5 ng of LH per milliliter to this medium induced an approximately fourfold stimulation (31.81 ± 13.27), whereas further supplementing the medium with 5 mM of L-arginine did not cause a significant change (30.64 ± 7.81 ng/106 cells/h). While LH produced a statistically significant increase of T formation (P < .05), there was no such difference between its effects on the 2 media types. Adding the same amount of L-arginine to resting Leydig cells in LCMA failed to affect T production (10.14 ± 2.56 ng/106 cells/h, n = 3; Figure 3). Finally, the addition of 5 mM of L-arginine to normal LCM containing 0.1 mM of this amino acid also failed to cause a significant decrease in T production (data not shown). This indicated that basal NOS activity in Leydig cells is insufficient to negatively modulate T production.
|
Two NOS inhibitors, L-NAME (displaying eNOS preference) and L-NMMA (a nonselective blocker), had no discernible effect on the T production of resting rat Leydig cells. Moreover, these agents at a concentration of 1 mM did not show any considerable effect on the LH-induced elevation of T accumulation (Figure 4). Notably, while LH produced statistically significant increases of T formation (P < .05), there was no difference between T levels in incubations carried out in the absence or presence of the 2 blockers.
|
DNA Gene Array Assays
Table 2 illustrates the
expression level of several genes encoding enzymes relevant for
steroidogenesis in adult rat Leydig cells. The housekeeping gene ß-actin
was assigned a value of 1000, and all other genes are noted relative to this
value. The detection level is set at twice the standard deviation of the
noise, namely 2 x 2.7 = 5.4. Of the 3 NOS isoforms, only the endothelial
isoform exhibited a significant level of expression (10.38), while the other
two did not reach the detection level. Arginase 1, a member of the urea cycle
that metabolizes L-arginine to urea and L-ornithine, was
expressed in rat Leydig cells at a level slightly lower than that of eNOS (ie,
7.59, Table 2). In contrast to
these data, genes that are related to steroid biosynthesis were abundantly
expressed, ranging from 380.51 for 11-ßHSD-1 to 2493.21 and 8654.86 for
3ß-HSD and 17-hydroxylase, respectively.
|
RT-PCR Analyses
The results shown in Figure
5 clearly demonstrate that the levels of mRNA expression of eNOS
and nNOS in adult Leydig cells, as determined by RT-PCR analyses, are below
detection levels following a 20-cycle paradigm (panel A). Under the same
conditions, the message level for 17-hydroxylase in these cells, and
that of nNOS in the cerebellum, was high. In addition, there were detectable
levels of eNOS mRNA in the cerebellum (panel A).
|
RT-PCR and Griess Analyses of Testicular Macrophages
A high level of iNOS expression was noted in LPS-activated testicular
macrophages, whereas it was absent in Leydig cells
(Figure 5, panel B). Treatment
of testicular macrophages with LPS (10.0 µg/mL) for 24 hours resulted in a
significant (P < .01) nitrite accumulation in the medium (5.94
± 0.38 and 44.3 ± 7.3 [n = 3] nmol/105 cells/24 h,
for the control vs the LPS-stimulated samples, respectively). The population
of testicular macrophages in the adult rat testis is 7.5 x
106, compared to 26 x 106 Leydig cells
(Hardy et al, 1989). Using
these numbers, it can be calculated that 138 nmol of NO would be released by
activated macrophages per hour. Given an average volume of a rat testis of
1.66 cm3 and an interstitial volume of 0.35026 cm3
(Christensen and Peacock,
1980), the cumulative concentration of NO in the interstitial
milieu may reach 394 mM/h. Even allowing for just 1 second of NO accumulation
yields a concentration higher than 0.1 mM, which was observed to block T
production completely (Figure
2). Under the conditions used to activate macrophages, resting or
LPS-treated freshly isolated rat Leydig cells did not release nitrite into the
medium. Moreover, LPS had no effect on T production (32.36 ± 1.50 and
36.40 ± 2.04 [n = 3] ng/106 cells/24 h, for the basal vs the
LPS-stimulated samples, respectively).
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Studies localizing NOS proteins (Davidoff et al, 1995) and NOS activity (Burnett et al, 1995) to human and rat testis, respectively, were followed by reports on the effects of NO on T production. When purified Leydig cells were exposed to NO donors, a reduction in the production of T was observed (Del Punta et al, 1996). Subsequent analysis of NOS inhibition in testicular preparations provided further evidence that NO may act as an interstitial regulator of steroidogenesis (Welch et al, 1995). Robust support for the putative involvement of the L-arginine/NO pathway in steroid biosynthesis was provided by investigation of other endocrine organs. For example, NO donors reduce corticosterone production in rat adrenal zona fasciculata cells in vitro (Cymeryng et al, 1998). In addition, the NOS inhibitor L-NG-nitro-arginine brought about an increase in the synthesis of steroids in these cells. Moreover, the NOS substrate and NO precursor L-arginine decreased corticosterone levels (Cymeryng et al, 1999), adding more support to the hypothesis that endogenous formation of NO attenuates steroidogenesis. Indeed, our data demonstrate that the exogenous NO that was produced by GSNO inhibited the biosynthesis of T either by resting or LH-stimulated Leydig cells at concentrations in the low micromolar range (Figure 2). It is notable that previous studies (eg, Del Punta et al, 1996) using agents such as a diethylamine/NO complex (DEA/NO) required 3 orders of magnitude higher concentrations (ie, 0.5–1.0 mM) to obtain partial inhibition of T production.
We show that the omission of L-arginine from the incubation medium did not induce an increase in basal T production (Figure 3). In fact, an attempt to influence NO production in rat Leydig cells by elevating the extracellular concentration of L-arginine to 5 mM did not affect T production. Moreover, the rise in T production invoked by LH (0.5 ng/mL) was only slightly reduced by the addition of this high concentration of L-arginine (Figure 3). While this observation is in contrast with reports on the effect of L-arginine on estrogen (Vega et al, 1998) or corticosterone (Cymeryng et al, 1999) synthesis, it corroborates our results showing that the rate of L-[14C]arginine conversion in purified rat Leydig cell preparations is noticeably low (Table 1). The putative NOS activity measured in the membrane and cytosolic fractions of these cells amounts to less than one hundredth of that detected in the rat cerebellum and is significantly lower than that found in muscle tissue (Table 1) (Kobzik et al, 1994). Moreover, the calcium chelator EGTA failed to alter the minute quantity of L-citrulline formed by Leydig cell homogenates. Since the iNOS isoform is calcium independent (Xie et al, 1992), the failure of EGTA to decrease arginine conversion could be the result of the presence of a trace amount of this enzyme in rat Leydig cells. Nevertheless, the fact that a supramaximal concentration of the NOS inhibitor L-NAME was ineffective in blocking L-[14C]arginine conversion, and, in addition, failed to alter (ie, increase) T production, strongly indicates the absence of any NOS isoform in normal rat Leydig cells. This hypothesis received added support from other studies in which L-NAME did not increase T production in untreated and LPS-inflamed rats (O'Bryan et al, 2000a). In addition, unlike cells expressing either eNOS (Murray et al, 1986) or nNOS (Payne et al, 1982; Reiser, 1990; Wang et al, 1997) that exhibit a conspicuous Ca2+-evoked NO production, the NOS activity or T production in intact rat Leydig cells was not affected by the presence of 5 µM ionomycin.
According to Burnett et al (1995), the activity of NOS in the rat testis is remarkably low and is mainly confined to vascular endothelial cells, whereas Leydig cells do not exhibit any NADPH-diaphorase staining or L-citruline formation. These findings substantiate an earlier account showing no significant NOS activity in the human urogenital tract and Leydig cells (Ehren et al, 1994). While L-NAME potently blocked L-[14C]citrulline accumulation in various male rat reproductive tissues, this activity in the testis could be reduced by only 50% (Burnett et al, 1995). Using immunohistochemical techniques, eNOS has been detected in rat Sertoli, Leydig, and germ cells (Zini et al, 1996), nNOS was identified in Leydig cells by immunocytochemistry (Lissbrant et al, 1997), and constitutively expressed iNOS was proposed as a modulator of T production in these cells (O'Bryan et al, 2000a; Koksal et al, 2003). Nevertheless, these studies did not demonstrate enzyme activity in Leydig cells, and, in fact, it has been argued that the absence of NADPH-diaphorase activity in Leydig cells indicates the existence of an inactive form of nNOS (Lissbrant et al, 1997).
It has been proposed that iNOS is present in many cell types of the rat testis (O'Bryan et al, 2000a) but that it is absent from both normal and LPS-treated testicular macrophages. However, this conflicts with other results (Ehren et al, 1994; Gerdprasert et al, 2002), demonstrating the absence of iNOS activity in human and rat testes, respectively, and contrasts with our results (Figure 5). While iNOS was detected in numerous cell types in the testis, the application of L-NAME resulted in a decrease in T production in normal animals and had no effect when administered to LPS-treated rats (O'Bryan et al, 2000b). These results clearly rule out the involvement of endogenously generated NO in T production. As with other cell types exhibiting a barely detectable level of iNOS mRNA, immature rat Leydig cells have been shown to express this enzyme when challenged with proinflammatory cytokines (Tatsumi et al, 1997). Together, the reports that place NOS proteins in Leydig cells cast the putative functional role of NOS in these cells in doubt.
Our results suggest that the minor conversion of L-[14C]arginine observed is a product(s) of enzyme(s) activities other than NOS. A likely candidate for the transformation of L-arginine to a less basic amino acid in rat Leydig cells is arginase 1. The L-[14C]ornithine formed by this enzyme would then be monitored as L-[14C]citrulline by the assay used in this study. Indeed, the arginase 1 gene is expressed in Leydig cells at a level slightly lower than that of eNOS (Table 2). The combined activity of these 2 enzymes could account for the low L-[14C]arginine conversion products detected in this and other studies (Ehren et al, 1994; Burnett et al, 1995). Robust support for the biochemical data that imply the absence of NOS isoforms in rat Leydig cells is derived from DNA gene array and RT-PCR analyses (Table 2; Figure 5). In fact, while the former method showed that rat Leydig cells express the complete arsenal of steroidogenic enzymes and only a residual level of eNOS, the latter strengthened and emphasized these findings.
In summary, using several different experimental approaches, we present data leading to the conclusion that under normal in vitro conditions, rat Leydig cells are devoid of an L-arginine/NO pathway. It remains possible that some of the differences between the results of the present work and those previously indicating that Leydig cells are a source of NO are a result of differences observed in vitro and in vivo. However, most other steroid-producing tissues that express NOS do so even in vitro, suggesting that the in vitro conditions are not restrictive to this parameter. Figure 6 depicts the settings for the involvement of NO in Leydig cell function under basal and pathologic conditions. Leydig cells reside in the interstitial tissue that contains blood vessels, lymphatics, and macrophages. LH from testicular circulation stimulates Leydig cell T production, while LPS derived from testicular or systemic bacterial infection affects the adjacent testicular macrophages. As a result, NO is generated by the testicular macrophages and inhibits the neighboring Leydig cells. This model is based on the foundation that 1) T production is sensitive to NO (Adams et al, 1994; Del Punta et al, 1996; and results reported herein), and 2) Leydig cell T production was dramatically reduced when these cells were cocultured with either testicular or peritoneal macrophages (Sun et al, 1993; Pomerantz and Pitelka, 1998). By showing that an NO scavenger and an NOS inhibitor block the reduction in T production, the latter study provided evidence to support the notion that NO is the agent mediating the inhibitory action of activated macrophages. Thus, after we demonstrated that Leydig cells are essentially devoid of NOS activity, we showed that they are highly sensitive to exogenous NO. In purified Leydig cells, submicromolar concentrations of GSNO, an endogenous NO donor, decreased T secretion. In addition, testicular macrophages reside in close proximity to Leydig cells in the interstitial tissue and are known to secrete NO when activated. Close cellular proximity is crucial, since NO is an unstable free radical. Therefore, we infer that testicular macrophages are a likely source of NO under pathologic conditions.
|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein using the principle of protein-dye binding. Anal Biochem. 1976; 72: 248 -254.[CrossRef][Medline]
Bredt DS, Snyder SH. Isolation of nitric oxide synthetase, a
calmodulin-requiring enzyme. Proc Natl Acad Sci U S A. 1990; 87: 682
-685.
Burnett AL, Ricker DD, Chamness SL, Maguire MP, Crone JK, Bredt DS, Snyder SH, Chang TS. Localization of nitric oxide synthase in the reproductive organs of the male rat. Biol Reprod. 1995; 52: 1 -7.[Abstract]
Christensen AK, Peacock KC. Increase in Leydig cell number in testes of adult rats treated chronically with an excess of human chorionic gonadotropin. Biol Reprod. 1980; 22: 383 -391.[Abstract]
Cochran RC, Ewing LL, Niswender GD. Serum levels of
follicle-stimulating hormone, prolactin, testosterone,
5-dihydrotestosterone, 5-androstane-3,17ß-diol,
5-androstane-3ß,17ß-diol and 17ß-estradiol from male
beagles with spontaneous or induced benign prostatic hyperplasia.
Invest Urol. 1981; 19: 142
-147.[Medline]
Cutolo M, Balleari E, Giusti M, Monachesi M, Accardo S. Sex hormone status of male patients with rheumatoid arthritis: evidence of low serum concentrations of testosterone at baseline and after human chorionic gonadotropin stimulation. Arthritis Rheum. 1988; 31: 1314 -1317.[Medline]
Cymeryng CB, Dada LA, Colonna C, Mendez CF, Podesta EJ. Effects of
L-arginine in rat adrenal cells: involvement of nitric oxide synthase.
Endocrinology. 1999; 140: 2962
-2967.
Cymeryng CB, Dada LA, Podesta EJ. Effect of nitric oxide on rat adrenal zona fasciculata steroidogenesis. J Endocrinol. 1998;158: 197 -203.[Abstract]
Davidoff MS, Middendorff R, Mayer B, Holstein AF. Nitric oxide synthase (NOS-I) in Leydig cells of the human testis. Arch Histol Cytol. 1995;58: 17 -30.[Medline]
Del Punta K, Charreau EH, Pignataro OP. Nitric oxide inhibits Leydig cell steroidogenesis. Endocrinology. 1996; 137: 5337 -5343.[Abstract]
Di Rosa M, Radomski M, Carnuccio R, Moncada S. Glucocorticoids inhibit the induction of nitric oxide synthase in macrophages. Biochem Biophys Res Commun. 1990; 172: 1246 -1252.[CrossRef][Medline]
Diemer T, Ludwig M, Huwe P, Hales DB, Weidner W. Influence of urogenital infection on sperm function. Curr Opin Urol. 2000;10: 39 -44.[CrossRef][Medline]
Ehren I, Adolfsson J, Wiklund NP. Nitric oxide synthase activity in the human urogenital tract. Urol Res. 1994; 22: 287 -290.[CrossRef][Medline]
Eizirik DL, Delaney CA, Green MH, Cunningham JM, Thorpe JR, Pipeleers DG, Hellerstrom C, Green IC. Nitric oxide donors decrease the function and survival of human pancreatic islets. Mol Cell Endocrinol. 1996;118: 71 -83.[CrossRef][Medline]
Fenster L, Katz DF, Wyrobek AJ, Pieper C, Rempel DM, Oman D, Swan
SH. Effects of psychological stress on human semen quality. J
Androl. 1997;18: 194
-202.
Gerdprasert O, O'Bryan MK, Muir JA, Caldwell AM, Schlatt S, de Kretser DM, Hedger MP. The response of testicular leukocytes to lipopolysaccharide-induced inflammation: further evidence for heterogeneity of the testicular macrophage population. Cell Tissue Res. 2002; 308: 277 -285.[CrossRef][Medline]
Hales DB. Leydig cell–macrophage interactions: an overview. In: Payne AH, Hardy MP, Russell LD, eds. The Leydig Cell. Vienna, Ill: Cache River Press; 1996: 451 -465.
Hardy MP, Zirkin BR, Ewing LL. Kinetic studies on the development of the adult population of Leydig cells in testes of the pubertal rat. Endocrinology. 1989; 124: 762 -770.[Abstract]
Hutson JC. Development of cytoplasmic digitations between Leydig cells and testicular macrophages of the rat. Cell Tissue Res. 1992;267: 385 -389.[CrossRef][Medline]
Hutson JC. Interactions between testicular macrophages and Leydig
cells. J Androl. 1998; 19: 394
-398.
Hutson JC, Garner CW, Doris PA. Purification and characterization
of a lipophilic factor from testicular macrophages that stimulates
testosterone production by Leydig cells. J Androl. 1996; 17: 502
-508.
Klinefelter GR, Kelce WR, Hardy MP. Isolation and culture of Leydig cells from adult rats. Methods Toxicol. 1993; 3A: 166 -181.
Kobzik L, Reid MB, Bredt DS, Stamler JS. Nitric oxide in skeletal muscle Nature. 1994; 372: 546 -548.[CrossRef][Medline]
Koksal IT, Usta MF, Akkoyunlu G, et al. The potential role of advanced glycation end product and iNOS in chronic renal failure–related testicular dysfunction. An experimental study. Am J Nephrol. 2003;23: 361 -368.[CrossRef][Medline]
Kostic T, Andric S, Kovacevic R, Maric D. The involvement of nitric oxide in stress-impaired testicular steroidogenesis. Eur J Pharmacol. 1998;346: 267 -273.[CrossRef][Medline]
Lissbrant E, Lofmark U, Collin O, Bergh A. Is nitric oxide involved in the regulation of the rat testicular vasculature? Biol Reprod. 1997;56: 1221 -1227.[Abstract]
Mallis RJ, Buss JE, Thomas JA. Oxidative modification of H-ras: S-thiolation and S-nitrosylation of reactive cysteines. Biochem J. 2001;355: 145 -153.[CrossRef][Medline]
Moore C, Hutson JC. Physiological relevance of tumor necrosis factor in mediating macrophage–Leydig cell interactions. Endocrinology. 1994; 134: 63 -69.[Abstract]
Murray JJ, Fridovich I, Makhoul RG, Hagen PO. Stabilization and partial characterization of endothelium-derived relaxing factor from cultured bovine aortic endothelial cells. Biochem Biophys Res Commun. 1986;141: 689 -696.[CrossRef][Medline]
Nes WD, Lukyanenko YO, Jia ZH, Quideau S, Howald WN, Pratum TK,
West RR, Hutson JC. Identification of the lipophilic factor produced by
macrophages that stimulates steroidogenesis.
Endocrinology. 2000; 141: 953
-958.
O'Bryan MK, Schlatt S, Gerdprasert O, Phillips DJ, de Kretser DM,
Hedger MP. Inducible nitric oxide synthase in the rat testis: evidence for
potential roles in both normal function and inflammation-mediated infertility.
Biol Reprod. 2000a; 63: 1285
-1293.
O'Bryan MK, Schlatt S, Phillips DJ, de Kretser DM, Hedger MP.
Bacterial lipopolysaccharide-induced inflammation compromises testicular
function at multiple levels in vivo. Endocrinology. 2000b; 141: 238
-246.
Payne AH, Downing JR, Wong KL. Luteinizing hormone receptor and testosterone synthesis in two distinct populations of Leydig cells. Endocrinology. 1980; 106: 1424 -1429.[Abstract]
Payne AH, O'Shaughnessy PJ, Chase DJ, Dixon GE, Christensen AK. LH receptors and steroidogenesis in distinct populations of Leydig cells. [Review] [23 refs]. Ann N Y Acad Sci. 1982; 383: 174 -203.[Medline]
Pomerantz DK, Pitelka V. Nitric oxide is a mediator of the
inhibitory effect of activated macrophages on production of androgen by the
Leydig cell of the mouse. Endocrinology. 1998; 139: 922
-931.
Reiser G. Endothelin and a Ca2+ ionophore raise cyclic GMP levels in a neuronal cell line via formation of nitric oxide. Br J Pharmacol. 1990;101: 722 -726.[Medline]
Sun XR, Hedger MP, Risbridger GP. The effect of testicular macrophages and interleukin-1 on testosterone production by purified adult rat Leydig cells cultured under in vitro maintenance conditions. Endocrinology. 1993; 132: 186 -192.[Abstract]
Tatsumi N, Fujisawa M, Kanzaki M, Okuda Y, Okada H, Arakawa S,
Kamidono S. Nitric oxide production by cultured rat Leydig cells.
Endocrinology. 1997; 138: 994
-998.
Vega M, Johnson MC, Diaz HA, Urrutia LR, Troncoso JL, Devoto L. Regulation of human luteal steroidogenesis in vitro by nitric oxide. Endocrine. 1998;8: 185 -191.[CrossRef][Medline]
Wang Y, Goligorsky MS, Lin M, Wilcox JN, Marsden PA. A novel,
testis-specific mRNA transcript encoding an NH2-terminal truncated nitricoxide
synthase. J Biol Chem. 1997; 272: 11392
-11401.
Weissman BA, Gross SS. Measurement of NO and NO synthase. In: Crawley J, Gerfen C, Rogawski M, Sibley D, Skolnick P, eds. Current Protocols in Neuroscience. New York, NY: John Wiley & Sons Inc; 1998: 7.13.1-7.13.22.
Welch C, Watson ME, Poth M, Hong T, Francis GL. Evidence to suggest nitric oxide is an interstitial regulator of Leydig cell steroidogenesis. Metabolism. 1995; 44: 234 -238.[CrossRef][Medline]
Xie QW, Cho HJ, Calaycay J, et al. Cloning and characterization of
inducible nitric oxide synthase from mouse macrophages.
Science. 1992;256: 225
-228.
Zini A, O'Bryan MK, Magid MS, Schlegel PN. Immunohistochemical localization of endothelial nitric oxide synthase in human testis, epididymis, and vas deferens suggests a possible role for nitric oxide in spermatogenesis, sperm maturation, and programmed cell death. Biol Reprod. 1996;55: 935 -941.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  B. A. Weissman, C. M. Sottas, P. Zhou, C. Iadecola, and M. P. Hardy Testosterone production in mice lacking inducible nitric oxide synthase expression is sensitive to restraint stress Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E615 - E620. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Hutson Physiologic Interactions Between Macrophages and Leydig Cells Experimental Biology and Medicine, January 1, 2006; 231(1): 1 - 7. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Herman and C. Rivier Activation of a Neural Brain-Testicular Pathway Rapidly Lowers Leydig Cell Levels of the Steroidogenic Acute Regulatory Protein and the Peripheral-Type Benzodiazepine Receptor while Increasing Levels of Neuronal Nitric Oxide Synthase Endocrinology, January 1, 2006; 147(1): 624 - 633. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
