| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
,
,
,¶
,||
From the * Minneapolis VA Medical Center,
Minneapolis, Minnesota; the
Departments of
Laboratory Medicine and Pathology,
Urologic
Surgery, || Pharmacology, and ¶
Genetics, Cell Biology, and Development,
University of Minnesota, Minneapolis, Minnesota; and the
Minnesota Cancer Center, University of
Minnesota, Minneapolis, Minnesota.
| Correspondence to: Dr Michael J. Wilson, Research Service, VA Medical Center, One Veterans Dr, Minneapolis, MN 55417 (e-mail: wilso042{at}tc.umn.edu). |
| Received for publication May 21, 2003; accepted for publication November 11, 2003. |
| Abstract |
|---|
|
|
|---|
Key words: Tissue inhibitor of metalloproteinase-2, prostate cancer, Concanavalin A, reverse transcriptase-polymerase chain reaction
The expression of MMPs is found in both normal and pathological tissue changes in the prostate, and important roles for MMPs have been implicated in the progression of carcinoma of the prostate (Wilson, 1995). Primary human prostatic cancers express higher levels of MMP-2 protein and messenger RNA (mRNA) than normal prostate tissues (Stearns and Wang, 1993); and normal, hyperplastic, or neoplastic prostatic tissues secrete MMP-2 and MMP-9 and TIMP-1 and TIMP-2 in vivo (Wilson et al, 1993) and in organ culture (Lokeshwar et al, 1993). The balance of MMPs to TIMPs favors MMPs, since neoplastic prostate tumors secrete only trace amounts of TIMPs (Lokeshwar et al, 1993); and there is an increased ratio of MMP activities to immunoreactive TIMP-1 (Jung et al, 1998) and mRNA for MMP-2 to TIMP-2 (Still et al, 2000) in prostate cancer vs normal prostate tissues. Using immunohistochemical techniques, MMP-2 has been shown to be localized to basal and, to a lesser extent, secretory epithelial cells, but not to stromal cells, of normal prostate and benign prostatic hyperplasia (BPH) (Boag and Young, 1994; Montironi et al, 1996). mRNA for MMP-2 is weakly expressed in the secretory epithelium of the normal and benign hyperplastic prostate (Boag and Young, 1994) but is also localized to basal cells (Still et al, 2000). The number of transcripts for MMP-2 increases (Kuniyasu et al, 2000; Still et al, 2000), as does its protein, in prostatic intraepithelial neoplasia (PIN) and with progression to invasive cancer (Stearns and Wang, 1993; Boag and Young, 1994; Montironi et al, 1995, 1996). Malignant progression of prostate cancers and metastasis to lymph nodes are associated with an increase in the active, compared with the proenzyme, form of MMP-2 (Stearns and Stearns, 1996).
We have found that the progression to metastasis in established human prostate tumor cell lines is associated with the production of MMP-2 and MMP-9 (Wilson and Sinha, 1993) and that tumor growth factor beta (TGF-ß) induces the proenzyme but not the active forms of MMP-2 and MMP-9 in primary cultures of prostatic epithelial cells from normal, BPH, or prostatic cancer tissues (Wilson et al, 2002). The involvement of MMP-2 in tumor cell invasion and metastasis is more directly implicated by transfection studies in which MMP-2 was overexpressed in C127 breast cancer cells (Cockett et al, 1998) or MYU3L bladder cancer cells (nontransfected cells produce MMP-9 but are not metastatic) (Kawamata et al, 1995), creating an invasive and metastatic phenotype. The aggressive phenotype of cancer cells is associated with cell surface localization of MMP-2, the activation of which is thought to occur with binding of pro-MMP-2 to MT1-MMP complexed with TIMP-2 in plasma membranes (Emmert-Buck et al, 1995; Strongin et al, 1995; Lohi et al, 1996; Butler et al, 1998; Zucker et al, 1998). The activation of pro-MMP-2 in fibroblasts and some tumor cells is stimulated by a number of agents that increase the expression of MT1-MMP; these agents include Concanavalin A (Con A) (Overall and Sodek, 1990), monensin (Li et al, 1997), orthovanadate (Li et al, 1998), trifluoperazine (Ito et al, 1998), TGF-ß1 (Brown et al, 1990), soluble kappa elastin peptides (Brassart et al, 1998), and cytochalasin D (Aillenberg and Silverman, 1996). Pro-MMP-2 can be activated in cells treated with plasmin (Baramova et al, 1997) and thrombin (Zucker et al, 1995), but there is disagreement as to whether thrombin-induced MMP-2 activation is mediated through MT1-MMP (Nguyen et al, 1999; Lafleur et al, 2001). MT1-MMP is immunolocalized to secretory cells in human high-grade PIN and prostatic cancer cells (Upadhyay et al, 1999), and it is expressed in the androgen-independent human prostate cancer cell lines PC-3 and DU-145 but not in androgen-responsive LNCaP cells (Nagakawa et al, 2000; Jung et al, 2003). Thus, the control of cell surface localization and activation of MMP-2 is expected to be critical in prostatic neoplasia. The purpose of this study was to determine whether overexpression of MMP-2 in PC-3 human prostate cancer cells by transfection would result in increased secreted and/or cell-associated active MMP-2.
| Materials and Methods |
|---|
|
|
|---|
Transfection of PC-3 Cells With MMP-2![]()
We chose PC-3 prostate tumor cells for these studies, since they are the
more aggressive of the 3 established human prostate cancer cell lines with
respect to in vitro and in vivo (nude mice) invasion (see
Wilson, 1995). In addition,
PC-3 cells express more than 10-fold higher levels of MT1-MMP than DU-145
cells, and MT1-MMP is nearly undetectable in LNCaP cells
(Jung et al, 2003; Wilson et
al, unpublished data). PC-3 cells have also been characterized as having no
(Nakagawa et al, 2000) or low (Stearns and
Wang, 1991; Greene et al,
1997; Festuccia et al,
2000; Dong et al,
2001) levels of MMP-2 expression. The studies to establish stable
transfectants of PC-3 cells for MMP-2 were undertaken using 2 different
plasmids: pCR-3 vector only and pCR-MMP-2 employing the LipofectAMINE method
(Gibco BRL Life Technologies, Gaithersburg, Md). Stable transfectants were
selected with G418 (Pei and Weiss,
1996). Parental PC-3 cells, vector control cells, and MMP-2 stably
transfected cells from 10 independently derived clones were examined for the
level of MMP-2 expression through an analysis of its mRNA by employing
Northern blotting and for its protein by employing MMP zymography. Cell
morphology and proliferation rates were also closely monitored to examine for
possible artifacts in the clonal selection process.
Cell Proliferation and Wound Healing Migration Assays![]()
The rates of proliferation of the parental cells, vector control cells, and
MMP-2 transfected PC-3 cells were monitored by the MTT assay
(Romijin et al, 1988). The
cells were seeded at approximately 5 x 103 cells per well in
a 96-well tissue culture plate and grown in RPMI 1640 media plus 5%
heat-inactivated FCS. The number of cells was measured every 24 hours for 4
days.
Cell migratory behavior of the control and MMP-2 transfected PC-3 cells and of the HT-1080 cells was monitored to determine if the transfection of the protease changed this property of the tumor cells. Confluent monolayers of cells in 24-well plates were wounded with a pipette tip. After washing to remove free cells and cellular debris, the cells were cultured with RPMI 1640 media plus 5% FCS. The morphology of cells at the edge of the wound in the monolayer and the rate of closure of the void between the 2 edges of the cell layer were monitored by digital image analysis at 0, 8, and 24 hours.
In Vivo Lung Metastases of PC-3 Cells![]()
Male athymic nude mice (BALB/c, nu/nu) 45 weeks of age were obtained
from Simonsen Laboratories (Gilroy, Calif) and were housed on a constant
photoperiod (light-dark, 12:12) under barrier conditions. These mice were used
for the intravenous and subcutaneous injection of tumor cells under protocols
approved by the Animal Studies Committee of the Minneapolis VA Medical
Center.
Tumor cells were collected by the gentle scraping of culture flasks to suspend cells in PBS, pH 7.2. After washing in PBS, tumor cells were suspended in PBS (1 x 106 in 0.10 mL) for intravenous and subcutaneous injection. Mice (56 weeks old) in groups of 68 were injected via the tail vein or subcutaneously (3 per group) with 0.2 mL of a cell suspension of 4 different MMP-2 transfectant PC-3 cell sublines (MMP-2 production was verified in conditioned media via zymography), one vector only transfectant PC-3 subline, and with parental PC-3 cells. All mice were sacrificed 48 days after injection. The lungs of mice injected via the tail vein were removed and fixed in Bouin fluid. After washing in 70% ethanol, the surfaces of the lungs were examined for tumor nodules, after which they were embedded in paraffin, sectioned, and stained with hematoxylin and eosin for histology. The subcutaneous tumors were removed, and portions were frozen on dry ice for RNA isolation or tissue homogenization; other portions were fixed in Bouin fluid and examined histologically.
Treatment of Cells In Vitro![]()
HT-1080, PC-3 parental, PC-3 vector control, and MMP-2 transfected PC-3
cells were resuspended in culture media with serum before plating (1 x
105 cells/well) in 24-well plates for experimental protocols. After
72 hours, the cells were washed twice in serum-free medium and cultured in
serum-free media containing 0.2% lactalbumin hydrolysate for 24 hours. After
this, serum-free culture medium was used containing 0.2% lactalbumin
hydrolysate (200 µL/well) and the agent to be tested, and the cells were
cultured for an additional 2448 hours (2050 µg/mL Con A or
succinylated Con A [sCon A]; 2.5, 25, and 250 ng/mL phorbolmyristate acetate
[PMA]). The conditioned media were collected and centrifuged at 960 x
g for 10 minutes at 4°C, and the supernatant was saved. The cell
layer was washed with PBS and was lysed the with addition of sodium dodecyl
sulfate (SDS) sample buffer without 2-mercaptoethanol.
Preparation of Membranes![]()
Membrane fractions were prepared as described by Ward et al
(1991) with some
modifications. The control and Con Astimulated cells were scraped from
culture flasks into serum-free media and pelleted by centrifugation (960
x g, 5 minutes, 4°C). The cells were resuspended in cold 5
mM Tris HCl (pH 7.8) at 2 x 107/mL, maintained on ice for 10
minutes, and then passed 30 times through a 26-gauge needle. Crude membranes
were prepared by centrifugation of the cell lysate at 10 000 x
g for 15 minutes at 4°C. The supernatant was centrifuged at 105
000 x g for 1 hour at 4°C; then, the supernatant was
removed and saved, and the membrane fraction was resuspended in 20 mM Tris HCl
(pH 7.8), 10 mM CaCl2, and 0.05% Brij 35.
Immunofluorescent Microscopy![]()
HT-1080 and PC-3 parental cells were grown on coverslips in RPMI 1640 media
with 5% FCS. The media were changed to RPMI-1640 without FCS but containing 50
µg/mL of Con A and 5 µM of BB-94 (gift of British Biotech
Pharmaceuticals, Oxford, United Kingdom), and the cells were incubated for 24
hours. In brief, the cells were incubated with a fluorescein
isothiocyanatelabeled mouse antihuman MT1-MMP monoclonal antibody (R
& D Systems, Minneapolis, Minn), washed, and examined by confocal
microscopy (Model 1024 confocal microscope, BioRad, Richmond, Calif).
Zymography of Proteases![]()
Aliquots of the conditioned media and cell extracts prepared in SDS lysis
buffer without 2-mercaptoethanol were subjected to electrophoresis in
gelatin-containing polyacrylamide (9% acrylamide) gels in the presence of SDS
under nonreducing conditions (Heussen and
Dowdle, 1980; Wilson et al,
1993; Wilson and Sinha,
1993). The gels (0.75 mm thick) were electrophoresed for about 35
minutes at 200 V in a BioRad Mini-Protean II system. Following
electrophoresis, the gels were rinsed with distilled water and then washed
with gentle shaking at room temperature with 2.5% Triton X-100 (2 changes) for
1 hour. The gels were again rinsed with distilled water and incubated in 50 mM
Tris HCl (pH 8.4) containing 5 mM CaCl2. Incubation was overnight
(1820 hours) at 37°C. Following the incubation, they were stained
with Coomassie blue (Pharmacia, Piscataway, NJ). Areas of proteolysis appear
as clear zones against a blue background. Molecular mass determinations were
made by referencing prestained protein standards (BioRad) that were
coelectrophoresed in these gels. The dried zymograms were digitally scanned
into a Dell computer and processed using the Photoshop program.
Western Blot Analysis![]()
Immunoblotting was performed as described previously
(Pei and Weiss, 1996). The
conditioned media from PC-3 parental, PC-3 vector control, and PC-3 MMP-2
transfected cells grown in serum-free media, or in media with Con A or sCon A,
for 48 hours were concentrated 20-fold with a speed vac. The conditioned media
from HT-1080 cells were used without concentration. These media were separated
by SDS-polyacrylamide gel electrophoresis and blotted to nitrocellulose paper
electrophoretically, and the nitrocellulose blot was probed with a mouse
monoclonal antiTIMP-2 immunoglobulin G (IgG) (0.5 µg/mL) (R & D
Systems) and an alkaline phosphataseconjugated secondary antibody
(Invitrogen, San Diego, Calif). For the immunoblot detection of MT1-MMP, cell
extracts were prepared in radioimmunoprecipitation assay (RIPA) buffer (50 mM
Tris HCl, pH 7.5, 150 mM NaCl, 0.25% sodium deoxycholate, and 0.1% Nonidet
P-40) with protease inhibitors (10 mM leupeptin, 0.1 mM p-APMSF, and
1 mM aprotinin) were electrophoresed and blotted to nitrocellulose, which was
probed with a mouse monoclonal antibody to MT1-MMP (0.5 mg/mL) (Chemicon,
Temecula, Calif) and an alkaline phosphataseconjugated secondary
antibody.
Northern Blot Analysis![]()
Isolation of RNA was performed using TRIzol (Gibco BRL Life Technologies)
with a modified protocol provided by the supplier. The total RNA concentration
was determined by absorbency measurement at 260 nm, and the integrity of the
RNA was checked by electrophoresis in a 1.0% agarose gel and stained with
ethidium bromide. The expression of MT1-MMP was examined using a complementary
DNA (cDNA) probe for MT1-MMP that was an EcoRI-HindII
fragment (1.6 kb) isolated from the pCR3.1 MT1-MMP vector and radiolabeled
using a Redi-Prime (Amersham, Arlington Heights, Ill) kit and 32p-dCTP as
recommended by the supplier. The probe (109 cpm) was used for
Northern blotting with a Rapid Hyb Solution. For Northern blotting analysis of
MMP-2, the blot was probed with a cDNA fragment containing the entire coding
region that was isolated from a pCR3.1-Gel A vector
(Pei, 1999a).
Reverse Transcriptase-Polymerase Chain Reaction Analysis![]()
Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis was
carried out using a StrataGene ProStar HF Single-Tube RT-PCR System (HF) (La
Jolla, Calif) and an MJ Research PTC-150HB MiniCycler thermocycler (Watertown,
Mass). The RNA to be analyzed was stored in Formazol (Molecular Research
Center, Cincinnati, Ohio). At analysis, the RNA was diluted in water so that
approximately 0.1 µg of RNA (0.67% Formazol final concentration) was added
to each reaction mixture. RT-PCR was performed according to the manufacturer's
instructions with some modifications. The reaction mixture included 1x
HF buffer (StrataGene proprietary buffer), 100 ng of upstream primers, 100 ng
of downstream primers, 25 mM of deoxynucleotidetriphosphates, 3 U of RT, 2.5 U
of Taq polymerase, and 100 ng of RNA. The reaction mixture for TIMP-2
also included 15 mM of ammonium sulfate. The RT incubation was carried out for
15 minutes at 37°C for MMP-2 and TIMP-1 and at 42°C for TIMP-2. The
PCR program consisted of 2 minutes at 95°C to denature nucleic acids and
30 cycles of PCR (95°C for 30 seconds for denaturing, 60°C for 30
seconds for annealing, and 2 minutes at 68°C for elongation) and a final
10-minute extension at 68°C. Sense and antisense primers for PCR were
designed according to published cDNA sequences and were synthesized and
purchased from Gibco BRL Life Technologies. These included 1) human MMP-2,
sense CTGACATTGACCTTGGCACC; antisense TAGCCAGTCGGATTTGATGC, producing a 630-bp
band size (Brassart et al,
1998); 2) human TIMP-1, sense TTCGTGGGGACACCAGAAGTCAAC; antisense
TGGACACTGTGCAGGCTTCAGTTC, producing a 527-bp band size
(Wick et al, 1994); 3) human
TIMP-2, sense CTCGGCAGTGTGTGGGGTC; antisense CGAGAAACTCCTGCTTGGGG, producing a
364-bp band size (Brassart et al,
1998); and 4) GAPDH (glyceraldehyde 6 phosphate dehydrogenase)
sense ACCACAGTCCATGCCATCAC; antisense TCCACCACCCTGTTGCTGTA, producing a 443-bp
band size (Brassart et al,
1998). Following amplification, the samples were electrophoresed
in a 1.2% agarose gel containing ethidium bromide, 40 mM Trisacetate (pH 8.5),
and 2 mM EDTA (TAE) buffer. The gels were photographed using a Fotodyne MP4
Instant Image Camera with Foto UV System (Fotodyne Inc, New Berlin, Wis) and
Polaroid 667 film, and the images were digitally scanned into the Photoshop
program.
| Results |
|---|
|
|
|---|
|
Effects of Con A and PMA Treatment on MMP-2 Processing![]()
We examined the effects of Con A and PMA treatment on MMP-2 expression and
molecular processing in the MMP-2 transfected PC-3 cells. Treatment of other
cell types (primarily fibroblasts) with either of these agents has been
reported to stimulate activation of the proenzyme form of MMP-2
(Shofuda et al, 1998). Control
PC-3 MMP-2 transfected cells secreted primarily the proenzyme and only a small
level of the 62-kd form of MMP-2 (Figure
2). Treatment of these cells with 50 µg/mL of Con A for 48
hours resulted in a small increased proportion of secreted 62-kd MMP-2 and the
appearance of a minor band of 59 kd. However, in cell extracts of the Con
Atreated MMP-2 transfected cells, the lower-molecular-weight form of
MMP was primarily the active 59-kd form. The level of molecular processing of
pro-MMP-2 as found in the conditioned media of PC-3 MMP-2 transfected cells
stimulated by Con A is low compared with the response of HT-1080 cells to Con
A, in which most pro-MMP-2 was processed to the 62- and 59-kd molecular forms.
Treatment of PC-3 MMP-2 transfected cells with orthovanadate
(Li et al, 1998), monensin
(Li et al, 1997), or elastin
peptides (Brassart et al, 1998)
(data not shown) also did not produce pro-MMP-2 processing. There was no
effect of treatment with PMA, even at 250 ng/mL, or its ethanol control on the
molecular forms of MMP-2 in the conditioned media or cell extracts of PC-3
MMP-2 transfected cells. In addition, there was no effect for the PMA or Con A
treatment of PC-3 MMP-2 transfected cells on MMP-9 induction.
|
The Effect of Con A and sCon A on Processing of Pro-MMP-2![]()
Many of the effects of Con A on cells are mediated through the clustering
of cell surface molecules. This mediation is not seen with sCon A
(Reeke et al, 1974;
Yu et al, 1997). The response
of PC-3 and PC-3 MMP-2 transfected cells to Con A and sCon A with respect to
the processing of pro-MMP-2 was examined
(Figure 3). PC-3 cells did not
produce or secrete zymogram-detectable MMP activities, whereas the PC-3 MMP-2
transfected cells secreted predominantly the proenzyme form of MMP-2
(Figure 3). The low level of
MMP-2 activity of 62 kd in the conditioned media did not change substantially
upon incubation with Con A or sCon A. However, in cell lysates of Con
Astimulated PC-3 MMP-2 transfected cells, there was an increase in the
62-kd form of MMP-2, an effect not produced by sCon A. HT-1080 serum-free
conditioned media that contained pro-MMP-2 and pro-MMP-9 were added to PC-3
parental and MMP-2 transfected cells. There was a small conversion of
pro-MMP-2 to the 62-kd form in the media at 24 hours of incubation for these
cell groups, an observation that was not changed by Con A or sCon A treatment.
However, there was a notable Con Astimulated binding of pro-MMP-9 to
PC-3 and PC-3 MMP-2 transfected cells, as evidenced by an increased pro-MMP-9
activity in cell lysates. The binding of pro-MMP-9 to PC-3 and PC-3 MMP-2
transfected cells was not induced by sCon A.
|
TIMP-1, TIMP-2, and MT1-MMP Expression![]()
The activation of pro-MMP-2 at the cell surface is postulated to involve
the binding of pro-MMP-2 to an MT1-MMP/TIMP-2 complex followed by the cleavage
of the propeptide from MMP-2 (Strongin et
al, 1995). HT-1080 and PC-3 control and MMP-2 transfected cells
expressed TIMP-1 and TIMP-2 transcripts
(Figure 4). However, MMP-2 mRNA
is seen only in HT-1080 cells and PC-3 cells transfected with MMP-2. Since the
PC-3 MMP-2 transfected cells also express MT1-MMP mRNA
(Figure 1), the transcripts for
all the participants in pro-MMP-2 activation are present. Since our data
showed a limited amount of processing of pro-MMP-2 by PC-3 MMP-2 transfected
cells (Figures
1,2,3),
we examined PC-3 cells for the expression of TIMP-2 and MT1-MMP proteins.
Western blot analysis of the conditioned media showed the secretion of TIMP-2
by PC-3 parental, vector control, and MMP-2 transfected cells
(Figure 5A). The amount of
secreted TIMP-2 was not affected by treatment of cells with Con A or sCon A.
MT1-MMP proteins of 60 and 65 kd were detected in PC-3 parental and MMP-2
transfected PC-3 cells (Figure
5B). The level of MT1-MMP protein expressed, however, is
substantially lower than that found in HT-1080 cells. The low level of
activation of MMP-2 by PC-3 cells with Con A treatment may be due to an
overabundance of the TIMP-2 inhibitor and/or a low level of cell
surfaceactive MT1-MMP.
|
|
Effects of Serine Protease Inhibitors and Cyclic Adenosine Monophosphate on Pro-MMP-2 Processing![]()
The processing of pro-MMP-2 to lower-molecular-weight forms by PC-3
transfected cells is stimulated to a limited extent by Con A, especially when
compared to control HT-1080 cells (Figure
6). In view of reports of plasmin and thrombin cell-mediated
effects on MMP-2 activation (Zucker et al,
1995; Baramova et al,
1997), the effects of serine protease inhibitors on the low level
of pro-MMP-2 processing were examined. Incubation of PC-3 MMP-2 transfected
cells with the serine protease inhibitors
-aminocaproic acid and
amiloride was able to block the processing of pro-MMP-2 to
lower-molecular-weight forms, as was incubation with dexamethasone. These data
indicate that a serine protease may be involved in some step of pro-MMP-2
processing. Urokinase may be involved at some stage in this process, since
amiloride selectively inhibits urokinase
(Vassali and Belin, 1987), and
dexamethasone stimulates an increase in plasminogen activator inhibitor-1
(Coleman et al, 1986). The Con
A stimulation of MMP-2 activation in cells such as HT-1080 is associated with
a transcriptional induction of MT1-MMP, and this induction can be repressed by
elevation of intracellular cyclic adenosine monophosphate (cAMP) levels
(Yu et al, 1998). The addition
of dibutyryl-cAMP directly, or of isoproterenol, which increases intracellular
cAMP, did not alter the Con A response in the PC-3 MMP-2 transfected cells.
This may indicate that the Con A effect in PC-3 cells is not mediated through
the induction of MT1-MMP.
|
Subcellular Distribution of MMP-2![]()
The subcellular distribution of MMP-2 in HT-1080 and PC-3 MMP-2 transfected
cells was examined by differential centrifugation. The activities of MMP-2
were higher in the heavy membrane/mitochondrial
(Figure 7B) and cytosol
(Figure 7D) fractions of
HT-1080 cells. The activities of the combined molecular forms of MMP-2 in
these 2 fractions were higher in the HT-1080 cells stimulated by Con A. For
the PC-3 MMP-2 transfected cells, the MMP-2 activities were higher in the
light membrane, plasma membraneenriched fraction
(Figure 7C). There was no
increased processing of pro-MMP-2 in the cell extract or any subcellular
fraction of Con Aincubated PC-3 transfected cells, but there was an
indication of increased pro-MMP-2 in the light membrane fraction of Con
Atreated cells.
|
Effect of Con A on Subcellular Distribution of MT1-MMP![]()
MT1-MMP was localized to intracellular sites by immunofluorescent
microscopy in both HT-1080 and PC-3 cells
(Figure 8A and C). When these
cells were exposed to 50 µg/mL Con A, HT-1080 cells showed a strong
localization of MT1-MMP on the cell surface
(Figure 8B), whereas PC-3 did
not show any demonstrable change in subcellular MT1-MMP localization
(Figure 8D). This change of
MT1-MMP subcellular localization was accompanied by the molecular processing
of pro-MMP-2 in HT-1080conditioned media to the active form by HT-1080
cells (Figure 8E). There was no
processing of pro-MMP-2 from HT-1080 conditioned by PC-3 cells
(Figure 8F).
|
| Discussion |
|---|
|
|
|---|
The molecular processing of pro-MMP-2 in MMP-2 transfected PC-3 cells is
very low, which may account for the low level of lung colonization that was
similar to that of the PC-3 parental cells. The lack of pliancy of PC-3 cells
in activating pro-MMP-2 is evidenced by the absence of an effect of PMA and
only marginal processing of MMP-2 in response to Con A treatment. Unlike some
other cell lines, PC-3 cells do not up-regulate MT1-MMP or translocate
existing MT1-MMP to the cell surface in response to Con A. Con A and
12-o-tetradecanoylphorbol 13-acetate (TPA) enhances MT1-MMP expression in
several cell lines, but only Con A stimulates pro-MMP-2 activation
(Shofuda et al, 1998).
However, both phorbol esters and Con A induce pericellular gelatinolytic
activity of HT-1080 cells (Lohi and
Keski-Oja, 1995). The limited activation observed in PC-3 MMP-2
transfected cells was blocked by incubation with the serine protease
inhibitors
-aminocaproic acid and amiloride. Although serine proteases
such as plasmin do not activate purified pro-MMP-2
(Murphy et al, 1989) but may
convert the intermediate 62-kd form to the 58-kd active form
(Baramova et al, 1997), these
serine protease inhibitors may block a proteolytic step leading to the
processing of the activator protease for pro-MMP-2. The cell surface
activation of exogenously added pro-MMP-2 to TPA-activated HT-1080 cells is
not blocked by
-aminocaproic acid or aprotinin
(Brown et al, 1990). However,
aprotinin and
-aminocaproic acid can block the cell-mediated activation
of TGF-ß1 (Sato and Rifkin,
1989; Cao et al,
1996), a growth factor that can induce MMP-2 in primary cultures
of prostate epithelial cells (Wilson et
al, 2002). There are varied responses of MMP-2 activation in other
cell types in response to agents that affect MT1-MMP expression. For example,
activation of MMP-2 occurs in HT-1080 cells but not in CCL-137 human embryonic
lung fibroblasts in response to Con A or PMA, even though there is an
up-regulation of the MT1-MMP mRNA by both of these cell types. The fibroblasts
did not process MT1-MMP to the 43-kd form that was associated with MMP-2
processing in HT-1080 cells (Lohi et al,
1996). Since there was no activation of pro-MMP-2 in the PC-3
MMP-2 transfected cells exposed to sCon A, which does not stimulate cell
surface protein clustering, the marginal activation in response to Con A may
reflect the nontranscriptional component of a Con Amediated response
(Yu et al, 1997). Since
elevation of cAMP levels in MDA-MB231 human breast cancer cells inhibits Con A
transcriptional effects on MT1-MMP expression and thus MMP-2 activation
(Yu et al, 1998), the absence
of inhibitory effects of dibutyryl-cAMP or isoproteronal treatment (raises
cAMP levels) on the low level of pro-MMP-2 processing by PC-3 MMP-2
transfected cells also suggests that the effect of Con A that was observed is
not through transcriptional effects on MT1-MMP.
Strongin et al (1995) proposed that the binding of TIMP-2 to the cell surface activated MT1-MMP complexes with pro-MMP-2, resulting in the cleavage and activation of MMP-2. The level of TIMP-2 secreted in 11 human cancer cell lines was inversely correlated with pro-MMP-2 activation; for example, HT-1080 cells that secrete a high level of TIMP-2 activate little pro-MMP-2 without stimulation, even though they have a high level of MT1-MMP mRNA expression (Shofuda et al, 1998). Pro-MMP-2 is activated in TIMP-2 transfected COS-1 cells with a low level of TIMP-2 expression but not in those with a higher level of TIMP-2 production (Cao et al, 1996). Con A or PMA treatment of HT-1080 cells increases MT1-MMP mRNA and MMP-2 activation, but it does not change the level of TIMP-2 expression (Lohi et al, 1996). The effect of Con A treatment may be to stabilize the complex of MT1-MMP with TIMP-2 on cell membranes, reducing the internalization and degradation of the complex (Shofuda et al, 1998). Thus, the low level of pro-MMP-2 activation in PC-3 MMP-2 transfected cells may be due, in part, to the inhibitory effects of an abundance of TIMP-2.
The low-level response of the MMP-2 transfected PC-3 cells to Con A would
appear to be due to changes in protein organization on the cell surface. This
might involve the binding of MMP-2 to PC-3 cells through an alternative
mechanism to MT1-MMP. Activation of MMP-2 by fibroblasts grown in type I
collagen lattices is mediated by the
2ß1 integrin receptor
(Seltzer et al, 1994) and
occurs intracellularly in the Golgi membranes
(Lee et al, 1997). The cell
surface localization of MMP-2 in fibroblasts is mediated via the
collagen-binding domain of the enzyme that binds pericellular type I collagen,
which is anchored to cell membrane ß1-integrins
(Steffensen et al, 1998). Another mechanism to localize MMP-2 on the cell surface is the binding of the
pro and active forms of the enzyme to integrin
vß3
(Brooks et al, 1996). However,
this mechanism appears to involve MT1-MMP, since the transfection of
vß3 into human melanoma cells that express MT1-MMP, MMP-2, and
TIMP-2, but do not activate MMP-2, does result in the activation of MMP-2.
Activated MT1-MMP and
vß3 colocalize on the cell surface of the
vß3 expressing MMP-2activating melanoma cells
(Hoffman et al, 2000). PC-3
prostate cancer cells and primary human prostate cancer cells, but not normal
prostatic epithelial cells or the noninvasive LNCaP human prostate cells,
express
vß3 (Zheng et al,
1999). This suggests that the lack of MMP-2 activation in PC-3
cells may reside in the expression or processing of the MT1-MMP protein. It is
clear that PC-3 cells, unlike HT-1080 cells, do not respond to Con A with
translocation of MT1-MMP to the cell surface. The low level of pro-MMP-2
activation by PC-3 MMP-2 transfected cells that was observed may be due to the
autocatalytic processing of cell surface MT1-MMP with the release of a 20-kd
soluble fragment with the catalytic center of the enzyme
(Lehti et al, 2000).
Alternatively, it has been proposed by Itoh et al
(2001) that pro-MMP-2
activation at the cell surface involves formation of homophilic complexes of
MT1-MMP. The limited pro-MMP-2 processing that was observed in the PC-3 MMP-2
transfected cells may be due to the low level of MT1-MMP protein expression
and hence dimer formation in these cells. However, the lack of pro-MMP-2
processing in sCon Atreated cells may result from an absence of cell
surface mobility of MT1-MMP, which leads to the formation of functional
MT1-MMP complexes better able to activate pro-MMP-2.
The control of pericellular proteolysis in prostate tumors may be mediated by a number of proteases working in concert. Up-regulation of MT1-MMP stimulated by Con A in SW1353 chondrosarcoma cells is accompanied by a coordinated activation of not only MMP-2 but also of MMP-9 and procollagenase 3 (Cowell et al, 1998). Thus, mechanisms that regulate activation of pro-MMP-2 and zymogen forms of other MMPs may lead to activation of multiple proteinases enhancing the invasive properties of these cells.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Baramova EN, Bajou K, Remacle A, L'Hoir C, Krell HW, Weidle UH, Noel A, Foidart JM. Involvement of PA/plasmin system in the processing of pro-MMP9 and in the second step of pro-MMP-2 activation. FEBS Lett. 1997;405: 157 162.[Medline]
Basbaum CB, Werb Z. Focalized proteolysis: spatial and temporal regulation of extracellular matrix degradation at the cell surface. Curr Opin Cell Biol. 1996; 8: 731 738.[Medline]
Birkedal-Hansen H, Moore WGI, Bodden MK, Windsor LJ,
Birkedal-Hansen B, DeCarlo A, Engler JA. Matrix metalloproteinases: a review.
Crit Rev Oral Biol Med. 1993; 4: 197
250.
Boag AH, Young ID. Increased expression of the 72-kd type IV collagenase in prostatic adenocarcinoma: demonstration by immunohistochemistry and in situ hybridization. Am J Pathol. 1994; 144: 585 591.[Medline]
Brassart B, Randoux A, Hornebeck W, Emonard H. Regulation of matrix metalloproteinase-2 (gelatinase A, MMP-2), membrane-type matrix metalloproteinase-1 (MT1-MMP) and tissue inhibitor of metalloproteinases-2 (TIMP-2) expression by elastin-derived peptides in human HT-1080 fibrosarcoma cell line. Clin Exp Metastasis. 1998; 16: 489 500.[Medline]
Brooks PC, Stromblad S, Sander LC, Von Schalscha TL, Aimes RT, Stetler-Stevenson WG, Quigley JP, Cheresh DA. Localization of matrix metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin alpha v beta 3. Cell. 1996; 85: 683 693.[Medline]
Brown PD, Levy AT, Marguilies IMK, Liotta LA, Stetler-Stevenson WG.
Independent expression and cellular processing of Mr 72,000 type VI
collagenase and interstitial collagenase in human tumorigenic cell lines.
Cancer Res. 1990; 50: 6184
6191.
Butler GS, Buler MJ, Atkinson SJ, et al. The TIMP2 membrane type 1
metalloproteinase "receptor" regulates the concentration and
efficient activation of progelatinase A. J Biol Chem. 1998; 273: 871
880.
Cao J, Rehemtulla A, Bahou W, Zucker S. Membrane type matrix
metalloproteinase 1 activates pro-gelatinase A without furin cleavage of the
N-terminal domain. J Biol Chem. 1996; 271: 30174
30180.
Cockett MI, Murphy G, Birch ML, O'Connell JP, Crabbe T, Millican AT, Hart IR, Docherty AJP. Matrix metalloproteinases and metastatic cancer. Biochem Soc Symp. 1998; 63: 295 313.[Medline]
Coleman P, Patel PD, Cwikel BJ, Rafferty UM, Sznycer-Luszuk R,
Gelehter TD. Characterization of the dexamethasone-induced inhibitor of
plasminogen activator in HTC hepatoma cells. J Biol
Chem. 1986;261: 4352
4357.
Cowell S, Knauper V, Stewart ML, et al. Induction of matrix metalloproteinase activation cascades based on membrane-type 1 matrix metalloproteinase: associated activation of gelatinase A, gelatinase B, and collagenase 3. Biochem J. 1998; 331: 453 458.
Dong Z, Nemeth JA, Cher ML, Palmer KC, Bright RC, Fridman R. Differential regulation of matrix metalloproteinase-9, tissue inhibitor of metalloproteinase-1 (TIMP-1) and TIMP-2 expression in co-cultures of prostate cancer and stromal cells. Int J Cancer. 2001; 93: 507 515.[Medline]
Emmert-Buck MR, Emonard HP, Corcoran ML, Krutzsch HC, Foidart JM, Stetler-Stevenson WG. Cell surface binding of TIMP-2 and pro-MMP-2/TIMP-2 complex. FEBS Lett. 1995; 364: 28 32.[Medline]
Festuccia C, Angelucci A, Gravina GL, Villanova I, Teti A, Abini A, Bologna M. Osteoblast-drived TGF-ß1 modulates matrix degrading protease expression and activity in prostate cancer cells. Int J Cancer. 2000;85: 407 415.[Medline]
Greene FG, Kitadai Y, Pettaway CA, von Eschenbach AC, Bucana CD, Fidler IJ. Correlation of metastasis-related gene expression with metastatic potential in human prostate carcinoma cells implanted in nude mice using an in situ messenger RNA hybridization technique. Am J Pathol. 1997;150: 1571 1582.[Medline]
Heussen C, Dowdle EB. Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Anal Biochem. 1980; 102: 186 202.
Hoffman UB, Westphal JR, Van Kraats AA, Rutter DJ, Van Muijen GNP.
Expression of integrin
vß3 correlates with a activation of
membranetype matrix metalloproteinase-1 (MT1-MMP) and matrix
metalloproteinase-2 (MMP-2) in human melanoma cells in vitro and in vivo.
Int J Cancer. 2000; 87: 12
19.[Medline]
Ito A, Yamada M, Sato T, Sanekata K, Sato H, Seiki M, Nagase H, Mori Y. Calmodulin antagonists increase the expression of membrane-type-1 matrix metalloproteinase in human uterine fibroblasts. Eur J Biochem. 1998;251: 353 358.[Medline]
Itoh Y, Takamura A, Ito N, Maru Y, Sato H, Sueaga N, Aoki T, Seiki M. Homophilic complex formation of MT1-MMP facilitates proMMP-2 activation on the cell surface and promotes tumor cell invasion. EMBO J. 2001;20: 4782 4793.[Medline]
Jung K, Lein M, Ulbrich N, Rudolph B, Henke W, Schnorr D, Loening SA. Quantification of matrix metalloproteinases and tissue inhibitors of metalloproteinases in prostatic tissue: analytical aspects. Prostate. 1998;34: 130 136.[Medline]
Jung M, Romer A, Keyszer G, Lein M, Kristiansen G, Schnorr D, Loening SA, Jung K. mRNA expression of the five membrane-type matrix metalloproteinases MT1-MT5 in human prostatic cell lines and their down-regulation in human malignant prostatic tissue. Prostate. 2003;55: 89 98.[Medline]
Kawamata H, Kameyama S, Kawai K, Tanaka Y, Nan L, Barch DH, Stetler-Stevenson WG, Oyasu R. Marked acceleration of the metastatic phenotype of a rat bladder carcinoma cell line by the expression of human gelatinase A. Int J Cancer. 1995; 63: 568 575.[Medline]
Kuniyasu H, Troncoso P, Johnston D, Bucana CD, Tahara E, Fidler IJ,
Pettaway CA. Relative expression of type IV collagenase, E-cadherin, and
vascular endothelial growth factor/vascular permeability factor in
prostatectomy specimens distinguishes organ-confined from pathologically
advanced prostate cancers. Clin Cancer Res. 2000; 6: 2295
2308.
Lafleur MA, Hollenberg MD, Atkinson SJ, Knauper V, Murphy G, Edwards DR. Activation of pro-(matrix metalloproteinase-2) (pro-MMP-2) by thrombin is membrane-type-MMP-dependent in human umbilical vein endothelial cells and generates a distinct 63 kDa active species. Biochem J. 2001;357: 107 115.[Medline]
Lee AY, Akers KT, Collier M, Li L, Eizen AZ, Seltzer JL.
Intracellular activation of gelatinase A (72-kDa type IV collagenase) by
normal fibroblasts. Proc Natl Acad Sci U S A. 1997; 94: 4424
4429.
Lehti K, Valtanen H, Wickstrom S, Lohi J, Keski-Oja J. Regulation
of membrane-type-1 matrix metalloproteinase activity by its cytoplasmic
domain. J Biol Chem. 2000; 275: 15006
15013.
Li L, Akers K, Eisen AZ, Seltzer JL. Activation of gelatinase A (72-kDa type IV collagenase) induced by monensin in normal human fibroblasts. Exp Cell Res. 1997; 232: 322 330.[Medline]
Li L, Eisen AZ, Sturman E, Seltzer JL. Protein tyrosine phosphorylation in signaling pathways leading to the activation of gelatinase A: activation of gelatinase A by treatment with the protein tyrosine phosphatase inhibitor sodium orthovanadate. Biochim Biophys Acta. 1998;1405: 110 120.[Medline]
Lohi J, Keski-Oja K. Calcium ionophores decrease pericellular
gelatinolytic activity via inhibition of 92-kDa gelatinase expression and
decrease of 72-kDa gelatinase activation. J Biol Chem. 1995; 270: 17602
17609.
Lohi J, Lehti K, Westermarck J, Kahari V-M, Keski-Oja J. Regulation of membrane-type matrix metalloproteinase-1 expression by growth factors and phorbol 12-myristate 13-acetate. Eur J Biochem. 1996; 239: 239 247.[Medline]
Lohi JL, Wilson CL, Roby JD, Parks WC. Epilysin: a novel human
matrix metalloproteinase (MMP-27) expressed in testis and keratinocytes and in
response to injury. J Biol Chem. 2001; 276: 10134
10144.
Lokeshwar BL, Selzer MG, Block NL, Gunja-Smith Z. Secretion of
matrix-metalloproteinases and their inhibitors (tissue inhibitor of
metalloproteinases) by human prostate in explant cultures: reduced tissue
inhibitor of metalloproteinase secretion by malignant tissues.
Cancer Res. 1993; 53: 4493
4498.
Massova I, Kotra LP, Fridman R, Mobashery S. Matrix
metalloproteinases: structures, evolution, and diversification.
FASEB J. 1998;12: 1075
1095.
McCawley LJ, Matrisian LM. Matrix metalloproteinases: they're not just for matrix anymore! Curr Opin Cell Biol. 2001; 13: 534 540.[Medline]
Montironi R, Fabris G, Lucarini G, Biagini G. Location of 72-kd metalloproteinase (type IV collagenase) in untreated prostatic adenocarcinoma. Pathol Res Pract. 1995; 191: 1140 1146.[Medline]
Montironi R, Lucarini G, Castaldini C, Galluzzi CM, Biagini G, Fabris G. Immunohistochemical evaluation of type IV collagenase (72-kd metalloproteinase) in prostatic intraepithelial neoplasia. Anticancer Res. 1996; 16: 2057 2062.[Medline]
Murphy G, Reynolds JJ, Hembry RM. Metalloproteinase and cancer invasion and metastasis. Int J Cancer. 1989; 44: 757 760.[Medline]
Nagakawa O, Murakami K, Yamamura T, Fujiuchi Y, Murata J, Fuse H, Saiki I. Expression of membrane-type 1 matrix metalloproteinase (MT1-MMP) on prostate cancer cell lines. Cancer Lett. 2000; 155: 173 179.[Medline]
Nagase H, Suzuki K, Itoh Y, Kan CC, Gehring MR, Huang W, Brew K. Involvement of tissue inhibitors of metalloproteinases (TIMPS) during matrix metalloproteinase activation. Adv Exp Med Biol. 1996; 389: 23 31.[Medline]
Nguyen M, Arkell J, Jackson CJ. Thrombin rapidly and efficiently activates gelatinase A in human microvascular endothelial cells via a mechanism independent of active MT1 matrix metalloproteinase. Lab Invest. 1999;79: 467 475.[Medline]
Overall CM, Sodek J. Concanavalin A produces a matrix-degradative
phenotype in human fibroblasts: induction and endogenous activation of
collagenase, 72-kDa gelatinase, and pump-1 is accompanied by the suppression
of the tissue inhibitor of matrix metalloproteinases. J Biol
Chem. 1990;265: 21141
21151.
Park HI, Ni J, Gerkema FE, Liu D, Belozerov VE, Sang QX. Protein,
nucleotide identification and characterization of human endometase (matrix
metalloproteinase-26) from endometrial tumor. J Biol
Chem. 2000;275: 20540
20544.
Pei D. Identification and characterization of the fifth member of
the membrane-type matrix metalloproteinase MT5-MMP. J Biol
Chem. 1999a;274: 8925
8932.
Pei D. CA-MMP: a matrix metalloproteinase with a novel cysteine-array, but without the classic cysteine switch. FEBS Lett. 1999b;457: 262 270.[Medline]
Pei D. MMP25/MT6-MMP/Leukolysin: a novel matrix metalloproteinase specifically expressed in the leukocyte lineage. Cell Res. 1999c;9: 291 303.[Medline]
Pei D, Weiss SJ. Transmembrane-deletion mutants of the
membrane-type matrix metalloproteinase-1 process progelatinase A and express
intrinsic matrix-degrading activity. J Biol Chem. 1996; 271: 9135
9140.
Reeke GN Jr, Becker JW, Cuningham BA, Gunther GR, Wang JL, Edelman GM. Relationships between the structure and activities of Concanavalin A. Ann N Y Acad Sci. 1974; 234: 369 382.[Medline]
Romijin JC, Verkoelen CF, Schroeder FH. Application of the MTT assay to human prostate cancer cell lines in vitro: establishment of test conditions and assessment of hormone-stimulated growth and drug-induced cytostatic and cytotoxic effects. Prostate. 1988; 12: 99 110.[Medline]
Sato Y, Rifkin DB. Inhibition of endothelial cell movement by
pericytes and smooth muscle cells: activation of a latent transforming growth
factor-ß1-like molecule by plasmin during co-culture. J Cell
Biol. 1989;109: 309
315.
Seltzer JL, Lee A-Y, Akers KT, Sudbeck B, Southon EA, Wayner EA, Eisen AZ. Activation of 72-kDa type IV collagenase/gelatinase by normal fibroblasts in collagen lattices is mediated by integrin receptors but is not related to lattice contraction. Exp Cell Res. 1994; 213: 365 374.[Medline]
Shofuda K-I, Moriyama K, Nishihashi A, et al. Role of tissue
inhibitor of metalloproteinases-2 (TIMP-2) in regulation of pro-gelatinase A
activation catalyzed by membrane-type matrix metalloproteinase-1 (MT1-MMP) in
human cancer cells. J Biochem. 1998; 124: 462
470.
Stearns M, Stearns ME. Evidence for increased activated metalloproteinase 2 (MMP-2) expression associated with human prostate cancer progression. Oncol Res. 1996; 8: 69 75.[Medline]
Stearns ME, Wang M. Regulation of kinensin expression and type IV
collagenase secretion in invasive human prostate PC-3 tumor sublines.
Cancer Res. 1991; 51: 5866
5875.
Stearns ME, Wang M. Type IV collagenase (Mr 72,000) expression in
human prostate: benign and malignant tissue. Cancer
Res. 1993;53: 878
883.
Steffensen B, Bigg HF, Overall CM. The involvement of the
fibronectin type II-like modules of human gelatinase A in cell surface
localization and activation. J Biol Chem. 1998; 273: 20622
20628.
Stetler-Stevenson WG. Matrix metalloproteinases in angiogenesis: a moving target for therapeutic intervention. J Clin Invest. 1999;103: 1237 1241.[Medline]
Still K, Robson CN, Autzen P, Robinson MC, Hamdy FC. Localization and quantification of mRNA for matrix metalloproteinase-2 (MMP-2) and tissue inhibitor of matrix metalloproteinase-2 (TIMP-2) in human benign and malignant prostatic tissue. Prostate. 2000; 42: 18 25.[Medline]
Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA, Goldberg
GI. Mechanism of cell surface activation of 72-kDa type IV collagenase:
isolation of the activated form of the membrane metalloprotease. J
Biol Chem. 1995;270: 5331
5338.
Upadhyay J, Shekarriz B, Nemeth JA, et al. Membrane type 1-matrix
metalloproteinase (MT1-MMP) and MMP-2 immunolocalization in human prostate
cancer: change in cellular localization associated with high-grad prostatic
intraepithelial neoplasia. Clin Cancer Res. 1999; 5: 4105
4110.
Vassali JD, Belin D. Amiloride selectively inhibits the urokinase-type plasminogen activator. FEBS Lett. 1987; 214: 187 191.[Medline]
Ward RV, Atkinson SJ, Slocombe PM, Docherty AJP, Reynolds JJ, Murphy G. Tissue inhibitor of metalloprotienases-2 inhibits the activation of 72 kDa progelatinase by fibroblast membranes. Biochim Biophys Acta. 1991;1079: 242 246.[Medline]
Wick M, Burger C, Brusselbach S, Lucibello FC, Muller R. A novel
member of human tissue inhibitor of metalloproteinases (TIMP) gene family is
regulated during G1 progression, mitogenic stimulation, differentiation, and
senescence. J Biol Chem. 1994; 269: 18953
18960.
Wilson MJ. Proteases in prostate development, function, and pathology. Microsc Res Tech. 1995; 30: 305 318.[Medline]
Wilson MJ, Norris H, Kapoor D, Woodson M, Limas C, Sinha AA. Gelatinolytic and caseinolytic proteinase activities in human prostatic secretions. J Urol. 1993; 149: 653 658.[Medline]
Wilson MJ, Sellers RG, Wiehr C, Melamud O, Pei D, Peehl DM. Expression of matrix metalloproteinase-2 and -9 and their inhibitors, tissue inhibitor of metalloproteinase-1 and -2, in primary cultures of human prostatic stromal and epithelial cells. J Cell Physiol. 2002;191: 208 216.[Medline]
Wilson MJ, Sinha AA. Plasminogen activator and metalloprotease activities of Du-145, PC-3, and 1-LN-PC-3-1A human prostate tumors grown in nude mice. Cell Mol Biol Res. 1993; 39: 751 760.[Medline]
Yu M, Bowden ET, Sitlani J, Sato H, Seiki M, Mueller SC, Tompson
EW. Tyrosine phosphorylation mediates ConA-induced membrane type 1-matrix
metalloproteinase expression and matrix metalloproteinase-2 activation in
MDA-MB-231 human breast carcinoma cells. Cancer Res. 1997; 57: 5028
5032.
Yu M, Sato H, Sieki M, Spiegel S, Tompson EW. Elevated cyclic MP suppresses ConA-induced MT1-MMP expression in MDA-MB-231 human breast cancer cells. Clin Exp Metastasis. 1998; 16: 185 191.[Medline]
Zheng D-Q, Woodard AS, Fornaro M, Tallini G, Languino LR. Prostatic
carcinoma cell migration via
vß3 integrins modulated by a focal
adhesion kinase pathway. Cancer Res. 1999; 59: 1655
1664.
Zucker S, Conner C, DiMassmo BI, Ende H, Drews M, Seiki M, Bahou
WF. Thrombin induces the activation of progelatinase A in vascular endothelial
cells. J Biol Chem. 1995; 270: 23730
23738.
Zucker S, Drews M, Conner C, et al. Tissue inhibitor of
metalloproteinase-2 (TIMP-2) binds to the catalytic domain of the cell surface
receptor, membrane type 1-matrix metalloproteinase 1 (MT1-MMP). J
Biol Chem. 1998;273: 1216
1222.
This article has been cited by other articles:
![]() |
X. Wang, M. J. Wilson, J. W. Slaton, A. A. Sinha, S. L. Ewing, and D. Pei Increased Aggressiveness of Human Prostate PC-3 Tumor Cells Expressing Cell Surface Localized Membrane Type-1 Matrix Metalloproteinase (MT1-MMP) J Androl, May 1, 2009; 30(3): 259 - 274. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |