Journal of Andrology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Munell, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Munell, F.
Journal of Andrology, Vol. 25, No. 1, January/February 2004
Copyright © American Society of Andrology

Increased Expression of Estrogen Receptor ß in Pachytene Spermatocytes After Short-Term Methoxyacetic Acid Administration

OSCAR M. TIRADO*, DAVID M. SELVA*, NÚRIA TORÀN{dagger}, CARLOS A. SUÁREZ-QUIAN{ddagger}, MICHELLE JANSEN§, DONALD P. MCDONNELL§, JAUME REVENTÓS* AND FRANCINA MUNELL*

From the * Unitat de Recerca Biomèdica and {dagger} Departament d'Anatomia Patològica, Hospital Materno-Infantil Vall d'Hebron, Barcelona, Spain; {ddagger} Department of Cell Biology, Georgetown University Medical Center, Washington, DC; and the § Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina.

Correspondence to: Dr Francina Munell, Unitat de Recerca Biomèdica, Hospital Materno-Infantil Vall d'Hebrón, Ps. Vall d'Hebrón, 119-129, 08035 Barcelona, Spain (e-mail: fmunell{at}vhebron.net).
Received for publication April 10, 2003; accepted for publication August 7, 2003.

   Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Degeneration of primary spermatocytes by apoptosis occurs during normal spermatogenesis, as well as in several pathological conditions, including exposure to specific testicular toxicants. The mechanisms that regulate the death and survival of primary spermatocytes, however, are still not well understood. The recent localization of estrogen receptor beta (ERß) and P450 aromatase in pachytene spermatocytes suggests a role for estrogens in this step of spermatogenesis. Using a well-known model of pachytene spermatocyte apoptosis in adult rats consisting of the administration of methoxyacetic acid (MAA), we investigated the participation of ERß during the initial phase of apoptosis, prior to germ cell loss. Adult rats were treated with a single intraperitoneal dose of MAA, and DNA laddering analysis confirmed apoptotic cell death in the testis. In enriched germ cell fractions and testis from MAA-treated animals, ERß mRNA increased significantly at 3 and 6 hours, respectively. Next, stage-specific induction of ERß mRNA was demonstrated by use of laser capture microdissection of seminiferous tubules in combination with semiquantitative reverse transcription-polymerase chain reaction. The ERß protein also increased significantly after 6 hours and was mainly immunolocalized in the cytoplasm of pachytene spermatocytes of afflicted tubules. The cytoplasmic localization was confirmed by Western blot analysis of isolated cytoplasmic and nuclear fractions of testicular extracts. Finally, the MAA activation of ERß was tested in vitro in HepG2 cells cotransfected with ERß and a reporter construct that contained a consensus estrogen responsive element. Addition of MAA at similar doses used in vivo elicited a similar estrogenic activation as did estradiol at 1 nmol/L concentration. The present results raise the possibility that cytoplasmic ERß participates in the apoptotic process of pachytene spermatocytes induced by MAA. Whether MAA interacts with ERß in the cytoplasm of primary spermatocytes, preventing the progression of the first meiotic division, however, remains to be determined.

     Key words: germ cell apoptosis, testicular toxicity, Laser Capture Microdissection



Adult mammalian spermatogenesis is a highly coordinated process that includes cellular proliferation, division, differentiation, and, paradoxically, programmed cell death. Spontaneous germ cell apoptosis, for example, has been morphologically and biochemically documented in spermatogonia (Allan et al, 1992), primary and secondary spermatocytes, and spermatids (Kerr, 1992; Brinkworth et al, 1995; Blanco-Rodríguez and Martínez-García, 1996). In this regard, the prophase of the first meiotic division is one of the most strictly controlled steps of spermatogenesis and is composed of several checkpoints common to its mitotic counterpart, as well as steps that are best characterized as specific to meiosis. When cellular defects exceed the capability of the meiotic repair machinery, the meiotic progression is arrested, and spermatocytes die by apoptosis (Sassone-Corsi, 1997). Given that meiotic arrest associated with spermatocyte apoptosis is not a rare finding in human testicular biopsies in patients with infertility of unknown origin, it is of great interest to identify those genes that control meiotic progression. As such, investigators recently used knockout mouse technology to try to identify potential genes that participate in the apoptotic process in pachytene spermatocytes (Reventós and Munell, 1997; Sassone-Corsi, 1997).

The relationship between sex steroids and germ cell survival/death in the testis has been the subject of extensive analysis and is known to entail the absolute requirement for androgens (Zirkin et al, 1989; Henriksen et al, 1995; Woolveridge et al, 1999), although the precise action(s) or the somatic cell most vitally responsive to androgens remains a matter of debate (Súarez-Quian et al, 1999). Of interest, a more comprehensive and emerging view of the hormonal control of spermatogenesis raises the possibility that androgens may not be the exclusive steroid responsible for its regulation and that estrogens may also participate in such capacity. First, germ cell apoptosis induced by incubating segments of human seminiferous tubules without survival factors can be inhibited by low concentrations of estradiol (Pentikainen et al, 2000). Second, estradiol treatment of the hypogonadal mouse, which congenitally lacks gonadotrophins and presents a meiotic arrest at the pachytene stage, induces the progression and completion of spermatogenesis in the absence of measurable androgen concentrations (Ebling et al, 2000). Third, estradiol treatment also induces the initiation of spermatogenesis in photo-regressed male Siberian hamsters (Park et al, 2002). Fourth, it has been shown that germ cells express cytochrome P450 aromatase (Nitta et al, 1993; Carreau and Levallet, 1997; Janulis et al, 1998, Levallet et al, 1998; Carreau et al, 2002) and that mice lacking functional aromatase are infertile and exhibit a reduction in round and elongated spermatids and an increase in germ cell apoptosis (Robertson et al, 1999).

A recently identified form of a second estrogen receptor, the estrogen receptor ß (ERß; Kuiper et al, 1996), was found to be expressed in pachytene spermatocytes as well as in other germ and/or somatic cells of the testis (Saunders et al, 1998; Van Pelt et al, 1999; Pentikainen et al, 2000; O'Donnell et al, 2001). Given that the survival of pachytene spermatocytes depends on androgens and no evidence of androgen receptors has been demonstrated in these cells, it is possible that androgens would somehow enter freely into germ cells (or be delivered by androgen-binding protein)—once there, they would be aromatized to estrogens. Alternatively, estrogens produced by testicular somatic cells (Carreau et al, 2002) could also enter into germ cells. In this scenario, ERß could mediate the effects of estradiol in the regulation of primary spermatocyte survival and/or apoptosis.

In the present investigation, we chose a well-established model of pachytene spermatocyte apoptosis consisting in a single intraperitoneal injection of methoxyacetic acid (MAA) in adult rats that results in almost complete loss of pachytene spermatocytes (Brinkworth et al, 1995), to examine whether the massive and stage-specific cellular apoptosis entailed the alteration of normal ERß levels. The temporal expression of ERß mRNA and protein was analyzed during the time course of the apoptotic process and compared with the results of morphological and biochemical apoptotic assays. Analysis of the spatial expression of ERß mRNA was achieved using laser capture microdissection (LCM) in combination with reverse transcription-polymerase chain reaction (RT-PCR) of stage-specific seminiferous tubules (Suárez-Quian et al, 2000; Tirado et al, 2003). Furthermore, the activation of ERß by MAA was tested in a cell-based transcription assay system using a luciferase reporter construct that contains a consensus estrogen responsive element cotransfected with ERß in HepG2 cells. The data presented provide evidence for the induction of ERß mRNA and protein prior to pachytene spermatocyte cell death by apoptosis and support the involvement of this receptor in the regulation of the meiotic progression of primary spermatocytes.


   Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals and Treatments

Forty-five adult male Sprague-Dawley rats, weighing approximately 400 g, were used for the present experiments. The animals were maintained in standard conditions. All experimental procedures were conducted in accordance with institutional standards, which fulfill the requirements established by the Spanish Government and the European Community (BOE 67, 3/18/88, Real Decreto 223/1988, and BOE 256, 10/25/90). Thirty-three rats were treated with a single intraperitoneal injection of MAA (650 mg/kg body weight; Sigma-Aldrich, Steinheim, Germany), buffered to 7.4 pH in 0.9% saline water, and killed at 3 (n = 6), 6 (n = 6), 9 (n = 6), 12 (n = 3), or 24 (n = 3) hours or 3 (n = 3), 5 (n = 3), or 7 (n = 3) days after the drug administration. Six rats were used as controls and were either treated with vehicle (saline water) or not treated. Animals were killed by CO2 asphyxiation. One testis from each animal was fixed in 4% paraformaldehyde for 24 hours and subsequently embedded in paraffin. The other testis was minced, immediately frozen, and used for DNA and RNA extraction, except for 12 rats (3 controls and 3 killed at 3, 6, and 9 hours), in which germ cell isolation preceded the DNA and RNA isolation. Serial 5-µm-thick sections, obtained from the 39 paraffin-embedded testis, were used for morphological examination after hematoxylin-eosin (H&E) staining, for in situ DNA fragmentation analysis, and for immunohistochemistry. Six additional animals, 3 controls and 3 rats killed after 12 hours of MAA administration, were used for LCM experiments.

DNA Isolation and DNA Fragmentation Analysis on Agarose Gel

Total DNA was isolated from individual frozen testes by digestion in lysis buffer (20 mmol/L Tris-HCl [pH 7.4], 1 mmol/L EDTA, and 1% sodium dodecyl sulfate [SDS]) and proteinase K (10 µg/mL) at 56°C overnight. DNA was extracted with phenol/chloroform and precipitated by the addition of sodium acetate and ethanol. The DNA was resuspended in low-TE buffer (20 mmol/L Tris-HCl [pH 7.4] and 1 mmol/L EDTA [pH 8]), and its concentration was measured by spectrophotometry. An equal amount of DNA from each sample was loaded onto 2% agarose gel and blotted to Hybond-N nylon membrane (Amersham) by overnight capillary transfer using 10x standard saline citrate (SSC; 3 mol/L NaCl and 0.3 mol/L trisodium citrate). Blots were hybridized at 42°C, overnight, using rat total genomic DNA labeled by random priming with 32P d-CTP as the probe (Macaya et al, 1994). Finally, the membranes were washed in decreasing concentrations of SSPE (3.6 mol/L NaCl, 0.2 mol/L Na2 HPO47H2O, and 0.02 mol/L EDTA)/0.1% SDS and autoradiographed.

Histological Examination and In Situ End Labeling of Fragmented DNA (TUNEL)

TUNEL assay was done as described elsewhere (Selva et al, 2000). In brief, dewaxed and rehydrated sections were treated with 20 µg/mL proteinase K for 15 minuutes and with 3% hydrogen peroxide for 5 minutes. After an incubation with terminal deoxynucleotidyltransferase (TdT) buffer (25 nmol/L Tris HCl, 200 mmol/L cacodylate acid, and 200 mmol/L KCl) for 15 minutes, sections were treated with 0.05 U/µL TdT (Roche Molecular Biochemicals, Mannheim, Germany) and 0.5 nM biotin-16-deoxy(d)UTP (Roche Molecular Biochemicals) in TdT buffer at 37°C for 90 minutes and with 300 mmol/L NaCl and 30 mmol/L SSC at room temperature for 15 minutes. After washing and incubating with 2% bovine serum albumin, sections were exposed to avidin-biotin complex (Vector Laboratories Inc., Burlingame, CA), diluted 1: 25, at 37°C for 45 minutes, and the peroxidase reaction was visualized with diaminobenzidine and hydrogen peroxide. Counting individually labeled cells in at least 3 sections per sample served as our quantitation protocol.

Germ Cell Isolation

Germ cells were isolated from the testis as described elsewhere (Weiss et al, 1997; Selva et al, 2000). Testes were excised and washed with phosphate-buffered saline (PBS) supplemented with penicillin-streptomycin (5 mg/mL) and amphotericin (5 mg/mL), decapsulated, minced, and incubated in 100 mL of the above PBS solution for 8 minutes. The medium was removed, and the remaining testicular pieces were digested in trypsin (80 mg/mL)/PBS at 33°C for 10 min. The reaction was stopped by the addition of 25 mg/mL trypsin inhibitor, and the resulting solution was treated with deoxyribonuclease (0.4 mg/mL) at room temperature for 5 minutes. The isolated tubules were minced in a petri dish for 30 minutes and sequentially filtered through a 100-µm pore size nylon filter, a fine glass-fiber filter, and a 20-µm pore size nylon filter. The recovered solution was centrifuged at 95 x g for 10 min, and the pellet was resuspended in 15 mL Dulbecco's minimum essential medium (DMEM)/Nutrient Mixture (NUT) mix F-12 culture medium (Life Technologies Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS). The cell suspension was incubated in the same medium in tissue culture flasks for 5 hours, and the supernatant, free of Sertoli cells, was recovered and centrifuged at 95 x g for 10 minutes. The pellet was frozen until its use for RNA extraction. This protocol ensures the purity of the germ cell fraction, as it has been shown using vimentin as a marker for Sertoli cell contamination (Selva et al, 2002).

Messenger RNA Isolation and Analysis of Its Expression by Semiquantitative RT-PCR

Total and messenger RNA were extracted from unseparated testicular cells and from isolated germ cells by means of guanidium thiocyanate/phenol-chloroform extraction (Chomzinsky and Sacchi, 1987) and by use of the Quickprep mRNA purification Kit (Pharmacia Biotech). One microgram of total RNA or, alternatively, 0.25 µg of eluted mRNA was reverse transcribed using 200 U of Superscript II Rnase H-Reverse Trancriptase (Gibco-BRL, Bethesda, MD), according to supplier's instructions. For rat ERß, a 735-bp product was amplified (upper primer: TGCTGGATGGAGGTGCTAATG, lower primer: ACACAACCACCCTGACTCCT) and for the rat ribosomal protein L19, a 486-bp fragment was obtained (upper primer: CAATGCCAACTCTCGTCAAC, lower primer: CTTGGTCTCTTCCTCCTTGG). Amplification consisted of 40 cycles for ERß and 32 cycles for the control gene L19, both within the linear growth phase of the PCR reaction. Annealing was done at 57°C for 30 seconds. PCR products were separated on a 2% agarose gel and quantified by the Molecular Analyst/Macintosh data analysis software using a Bio-Rad Image Analysis System (Bio-Rad Laboratories Inc., Hercules, CA). The products of amplification were purified using the QIA-quick PCR Purification Kit (Quiagen, Hilden, Germany), according to supplier's instructions, and sequenced using an Abi Prism 310 genetic analyzer (Perkin-Elmer Corp.).

ERß Immunohistochemistry

For ERß immunodetection, tissue sections were deparaffinized and treated with 10% methanol and 3% hydrogen peroxide in PBS for 5 min. The slides were then incubated with 3% normal rabbit serum and with 3 µg/mL of a goat anti-rat ERß polyclonal antibody that recognizes the amino terminus domain of the rat protein (sc-6821; Santa Cruz Biotechnology, Santa Cruz, CA), at 4°C, for 16 hours. After PBS washing, sections were exposed to biotinylated rabbit anti-goat IgG as a secondary antibody for 30 minutes (Vector Laboratories) and treated with avidin-biotin complex (Vectastain ABC Kit; Vector Laboratories) for 45 minutes. Bound peroxidase was visualized using 0.01% hydrogen peroxide and 0.05% diaminobenzidine in PBS.

Preparation of Cytoplasmic and Nuclear Extracts

Cytoplasm and nuclear extracts of total testis were prepared as follows: decapsulated testes were immersed in buffer A (10 mmol/L Tris-HCL [pH 7.4], 2 mmol/L EDTA, and 0.25 mol/L sucrose) that contained the protease inhibitors phenylmethylsulfonyl fluoride (0.2 mmol/L), aprotinin (5 mg/mL), and leupeptin (5 mg/mL). Testes were homogenized in a motorized homogenizer and then centrifuged at 800 x g for 10 minutes. The supernatant was centrifuged at 10 000 x g for 30 minutes, to obtain the cytosolic fraction. The nuclear pellet was washed and resuspended in RIPA buffer (50 mmol/L Tris-Cl [pH 7.5] and 150 mmol/L NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) that contained the protease inhibitors described above, then lysed in the homogenizer and centrifuged at 10 000 x g for 30 minutes. The supernatant was kept as the nuclear fraction.

Protein Extraction and Western Blot Analysis

Fractions of total testis were lysed with RIPA buffer that contained protease inhibitors (as described above), and the lysates were centrifuged at 13 000 x g at 4°C for 30 minutes. The protein content of the supernatant was determined by the Bradford assay (Bio-Rad Laboratories). Equals amounts of protein (30 µg) were resolved by 10% SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. After blocking, the membranes were incubated at 4°C overnight with 2 µg/mL of 2 rabbit polyclonal antibodies raised against the amino-terminal region of mouse ERß (sc-6821; Santa Cruz Biotechnology, and PA1-311; Affinity Bioreagents Inc., Golden, CO) and then for 1 hour at room temperature with horseradish peroxidase-conjugated secondary antibody (1: 2000). Peroxidase activity was analyzed with the ECL system (Amersham Pharmacia Biotech), according to the manufacturer's instructions. The ERß content was determined densitometrically. To confirm that similar amounts of protein were loaded onto each lane, membranes were stained with Coomassie brilliant blue R-250.

LCM

Stage-specific seminiferous tubules were harvested from frozen, testicular sections of control and MAA-administered rats by LCM, as described elsewhere (Suárez-Quian et al, 2000; Tirado et al, 2003). Specifically, 5-µm frozen sections were cut on a standard cryostat with a fresh blade, and 2 sections each were mounted on Colorfrost Plus glass slides (Fisher Scientific, Pittsburgh, PA). The unfixed sections were immediately stored at -80°C. The frozen sections were thawed at room temperature for 30-60 seconds without drying and immersed in 70% ethanol to fix for 30 seconds. After fixation, slides were stained with hematoxylin (1 minutes) and eosin (15 seconds), dehydrated in ascending grades of ethanol (70%, 90%, and 100%), twice in each for 1 minute, and immersed in Xylene, twice, for 5 minutes each. The seminiferous tubules were staged using the scheme of Leblond and Clermont (1952) and microdissected using a Pixell II apparatus (Arcturus, Mountain View, CA). An infrared laser pulse of 90 mW and beam size of 30 µm were pulsed over the tubules of interest, the ethylene vinyl acetate thermoplastic film was melted directly onto these tubules, and the captured tissue was transferred to a thermoplastic polymer film-coated cap by the 1-step transfer method. The transfer film cap was placed directly into a microcentrifuge tube for RNA extraction.

Total RNA Extraction from Captured Seminiferous Tubules

Total RNA was obtained from microdissected tubules by using the Micro RNA isolation Kit (Stratagene, La Jolla, CA), according to the manufacturer's instructions.

Cell Culture and Transient Transfection Assay

Human hepatoma (HepG2) cells were maintained at 37°C, 5% CO2 in MEM (Invitrogen Corp., Carlsbad, CA) containing phenol red and supplemented with 10% FBS (Hyclone Laboratories Inc., Logan, UT), 1 mmol/L sodium pyruvate, and 100 nmol/L nonessential amino acids (Invitrogen). Cells were seeded into 24-well plates at 60% confluence 24 hours before transfection. Cells were washed once with 1x PBS and transfected with a lipofectin (Invitrogen)-DNA mixture that contained 3 µg total DNA per triplicate. Transfection mixtures contained 2000 ng 3x ERE TATA Luc, 100 ng CMV ß-galactosidase, 500 ng pRST7 hERß, and 400 ng pBS-KSII+ (Stratagene). After a 5-hour transfection, medium was replaced with phenol red-free MEM supplemented with 10% dextran-stripped FBS (Hyclone Laboratories), 1 mmol/L sodium pyruvate, and 100 nmol/L nonessential amino acids. The cells were incubated for 16 hours before 17ß-estradiol or increasing concentrations of MAA were added to the transfected cells and treated for 24 hours. A 20-mmol/L stock MAA solution was prepared by adding 98% pure MAA to the medium and adjusting the pH to 7.4 with 10 N NaOH. Subsequently, the cells were lysed and assayed for luciferase and ß-galactosidase activities. Luciferase activity was divided by ß-galactosidase activity, to normalize for transfection efficiency. Data are presented as the average of triplicate transfections, and the assay was repeated 3 times.

Statistical Analysis

For experiments shown in Figures 2, 4, 5, and 6 below, at least 3 replications were used for each group within an experiment. Analysis of variance was used to assess statistical significance between group means, and groups were considered to be statistical different at P <= .05.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Changes of ERß mRNA levels during pachytene spermatocyte apoptosis induced by MAA administration. A representative agarose gel showing the RT-PCR results obtained when the unseparated testicular cells (TT) and isolated germ cells (GC) of control (C) and MAA exposed rats at different time-points were amplified using specific primers for rat ERß and L19. The ratios between the ERß and L19 band intensity were calculated and represented in the lower graph. In isolated germ cells, a significant increase in ERß mRNA versus control was noted 3-12 hours after MAA administration, whereas when testicular cells that were not separated were analyzed, a significant increase in ERß mRNA was not detected until 6 h after MAA exposure. Asterisk represents significance at P < .05.

 


View larger version (54K):
[in this window]
[in a new window]
 
Figure 4. Changes of ERß protein levels during pachytene spermatocytes apoptosis induced by MAA administration. Western blot analysis of proteins isolated from cytoplasmic and nuclear testicular extracts of control rats (C) and rats killsed at different time points (6, 9, 12, and 24 hours) after MAA administration were done using 2 antibodies (SCB: Santa Cruz Biotechnology, and ABR: Affinity Bioreagents Inc.) raised against the N-terminal region of the ERß. Representative blots and the mean and standard deviation values of ERß are illustrated. Both antibodies recognized a single 55-kDa-specific band that was blocked when the SCB antibody was incubated with the corresponding peptide (lower panel). Although the expression of the ERß protein was present in both the cytoplasmic and nuclear extracts, the most significant increase was detected in the cytoplasm 6-24 hours after the MAA administration.

 


View larger version (45K):
[in this window]
[in a new window]
 
Figure 5. Analysis of the stage specific ERß mRNA expression by LCM in the testis of control rats and after 12 hours of MAA administration. The stages of the seminiferous epithelium were identified in cryostat sections, fixed in ethanol, and stained with H and E (A), and the stages of interest (III, VII, and XII) were harvested by LCM (B). The mRNA isolated from selected tubules was retrotranscribed and amplified using specific primers for ERß and L19. A representative blot and the mean and standard deviation values of the ERß/L19 ratios obtained from the 3 controls and 3 MAA-exposed rats at 12 hours are illustrated (C). Note that the expression of ERß was low but detectable in stages VII and XII of control testis and increased significantly after the MAA administration. ERß mRNA represent both Sertoli and germ cell levels, because not attempts were made to separate Sertoli cells from the targeted and captured material.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Stimulation of ERß-mediated transactivation of a reporter gene by MAA. HepG2 cells were cotransfected with 2 µg of the luciferase reporter gene driven by 3 copies of a consensus estrogen response element (3x ERE TATA Luc), 500 ng pRST7-ERß, 100 ng pCMV-ß-galactosidase, and 400 ng pBSKSII. After transfection, cells were incubated for 16 hours in phenol red-free medium that contained charcoal-stripped fetal bovine serum. Cells were then treated for 24 hours with vehicle, 17ß-estradiol (E2), or increasing concentrations of MAA. Cell lysates were assayed for luciferase and ß-gal activities. Luciferase activity was normalized to ß-galactosidase activity as a control for transfection efficiency. Data are presented as the averages of triplicate transfections.

 


   Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Apoptosis in Pachytene Spermatocytes after MAA Administration

A single intraperitoneal dose of MAA leads to significant apoptosis in rat testis, as revealed by the appearance of a laddering pattern when the total genomic testicular DNA was electrophoresed in agarose gel, blotted, and hybridized with total rat DNA as a probe. This characteristic pattern, the hallmark of apoptosis, was observed in testicular samples obtained 24 hours after MAA administration, as described elsewhere (Brinkworth et al, 1995), and no laddering was detected in testes removed at 3, 5, and 7 days after MAA administration (data not shown). No DNA fragmentation was noted in control testes.

To further characterize the experimental model, TUNEL assays were done in the testis of the MAA-treated animals as well in controls. In control testes, isolated TUNEL-labeled cells were detected in some seminiferous tubules, but, in general, there was a lack of positive staining in most tubule profiles (Figure 1A). At 3 and 6 hours after MAA administration, there were no significant differences in the number of TUNEL-labeled cells, compared with control testes, but a gradual increase was noted at 9-12 hours that remained high at 24 hours. The majority of labeled cells were identified as pachytene spermatocytes (Figure 1B). Three days after the administration of MAA, primary spermatocytes were absent in most tubule stages and only a few, isolated labeled cells, identified as degenerating spermatogonia, could be discerned. Similar images were obtained in testis analyzed at 5 and 7 days after the toxicant (data not shown).



View larger version (144K):
[in this window]
[in a new window]
 
Figure 1. TUNEL assay in testicular sections of control rats (A) and rats killed after 24 hours of MAA administration (B). Note the specific TUNEL staining in some tubule sections whose stages of the cycle of the seminiferous epithelium are indicated by roman numerals.

 

Examination of TUNEL labeling at low magnification revealed a stage-specific distribution of the reaction product in pachytene spermatocytes beginning 6 hours after the compound's administration (Table 1). Although positive TUNEL staining was present in the majority of stages, maximal staining was observed in latter stages of the cycle of the seminiferous epithelium, specifically at stages X-XIII.


View this table:
[in this window]
[in a new window]
 
Quantification of the TUNEL-labeled pachytene spermatocytes as a function of the seminiferous epithelium stage. Three different rats killed at each time point after the administration of MAA were used, and the TUNEL-positive pachytene spermatocytes were counted in 10 testicular cross-sections per animal. Data are expressed as the percentage of TUNEL-positive pachytene spermatocytes
 

ERß mRNA Expression after MAA Administration

The levels of ERß mRNA were examined by semiquantitative RT-PCR in both unseparated testicular cells (a total testis cell fraction) and in isolated gem cells. In the unseparated testicular cells, a significant increase in ERß mRNA expression became noticeable at 6 hours after MAA administration and remained altered after 9 hours. In the isolated germ cells, although a progressive increase was noted starting at 3 hours (Figure 2), a significant increase in the ERß mRNA levels was not discerned until 9 hours after MAA exposure. The sequence analysis of the products confirmed the identity of the amplified cDNA bands with the sequences used to design the primer probes.

ERß Immunodetection in Pachytene Spermatocytes after MAA Administration

In previous immunohistochemical studies, ERß was shown to reside in the nuclei of Sertoli cells and pachytene spermatocytes, although no differential stage-specific intensity immunostaining was observed (Saunders et al, 1998). Using an antibody against the amino-terminal region of ERß, we also examined its distribution in control and in MAA-treated rats (Figure 3). In control animals, ERß immunoreactivity was present in the nuclei of Sertoli cells and pachytene spermatocytes and in the cytoplasm of pachytene spermatocytes and elongated spermatids, although this latter labeling appeared as a faint but widespread immunostaining (Figure 3A). In some tubules, however, robust ERß immunostaining could be observed in isolated pachytene spermatocytes appearing to be in a state of cell degeneration. These degenerating cells were characterized by chromatin clumping and a lack of cytoplasmic density. Beginning at 9 hours and remaining up to 24 hours after MAA administration, an intense ERß immunostaining was noted in the cytoplasm of a significant number of pachytene spermatocytes residing in stages X-XIII of the cycle of the seminiferous epithelium (Figure 3B-E), corresponding to the stages with increased number of TUNEL-labeled cells (Figure 3F and 3G). In stages II-III, a lower (but readily detectable) number of cells were also positive for ERß (Figure 3C) and TUNEL (Figure 3F). In stages VII-VIII, a faint ERß immunostaining was observed only in a few pachytene spermatocyte cells (Figure 3D), but no TUNEL labeling was ever detected in the pachytene spermatocytes inhabiting these stages (Figure 3G). Furthermore, careful inspection of the ERß immunohistochemistry of labeled pachytene spermatocytes revealed a significant, punctuate immunostaining within the nuclei of the cells. However, because of the high intensity of the cytoplasmic reaction in pachytene spermatocytes of MAA-treated rats, the reaction was stopped earlier in these sections than in controls, and the nuclear immunostaining was often masked and easily missed unless a thorough focus of the pachytene spermatocyte nucleus was done.



View larger version (147K):
[in this window]
[in a new window]
 
Figure 3. Immunohistochemical localization of ERß in control and MAA-exposed rats and stage-specific colocalization with TUNEL labeling. In control rats, ERß labeling was found predominantly in Leydig and Sertoli cells (arrow), although a faint staining (barely detectable at this magnification) was observed in some pachytene spermatocytes and elongated spermatids (A). At 24 hours after the MAA administration, a marked ERß immunostaining was noted in the cytoplasm of a significant number of pachytene spermatocytes in a stage-dependent fashion (B). This enhanced cytoplasmic staining of ERß in pachytene spermatocytes is clearly visible in panels C and E. A comparison between ERß immunostaining (C-E) and TUNEL staining (F-G) illustrates that robust ERß cytoplasmic staining is coincident with TUNEL staining of pachytene spermatocytes residing in late-stage tubules. The stages of the cycle of the seminiferous epithelium are indicated with roman numerals.

 

Up-regulation of ERß Protein after MAA Exposure Measured by Western Blot Analysis

To verify the results obtained by inmunohistochemistry, Western blot analysis was done in cytosolic and nuclear testicular extracts, using 2 different antibodies raised against peptidic sequences of the N-terminal region of rat ERß. Both antibodies recognized a single 55-kDa protein species, and the specificity of the reaction was demonstrated by the disappearance of the band when one of the antibodies (Santa Cruz Biotechnology) was incubated with the corresponding peptide (Figure 4). Expression of the ERß protein was detected in the cytoplasmic and nuclear fractions, but the most significant increase was noted in the cytoplasmic fraction during the time course of the experiment (Figure 4), in agreement with the results obtained by immunohistochemistry.

Capture of Seminiferous Tubules in a Stage-Specific Manner and mRNA Expression of ERß

LCM was done successfully using frozen testicular sections fixed with 70% ethanol, obtained from 3 control rats and 3 rats killed 12 h after the MAA administration. The different stages of the seminiferous epithelium were optically identified in H&E-stained sections at 630x magnification (Figure 5A). A total of 50 seminiferous tubules, at stages III-IV, VII-VIII, or X-XIII, respectively, were selected for microdissection. The stage-specific tubular sections were captured without interstitial contamination (Figure 5B). The mRNA expression of ERß and L19 as a control was analyzed in the RNA extracted from these tubules by RT-PCR using the specific primers already described. A clear up-regulation of ERß mRNA was observed in all tubules obtained from injected animals, compared with controls (Figure 5C).

MAA Effects on ERß

Direct effects of MAA on ERß activation were examined using HepG2 cells stably cotransfected with a specific ERß-responsive element and a luciferase reporter system. Results indicated that MAA at 5 mmol/L had an identical ability to activate the ERß as estradiol at 1 nmol/L concentration (Figure 6).


   Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
We investigated the possible role of ERß in pachytene spermatocyte apoptosis induced by the well-known in vivo and in vitro testicular toxicant MAA (Foster et al, 1987; Bartlett et al, 1988). As previously demonstrated, the administration of MAA to adult rats caused a massive and highly specific depletion of primary spermatocytes 24 hours after treatment (Brinkworth et al, 1995; Clark et al, 1997). To further examine the short-term effect of MAA on spermatogenesis, MAA was administered via a single intraperitoneal injection instead of by gavage, a route previously demonstrated to also exercise a long-term, deleterious effect on pachytene spermatocytes (Krishnamurthy et al, 1998). In the present study, DNA fragmentation was assayed by means of TUNEL, and it was first detected in pachytene spermatocytes 9 hours after the MAA administration and reached maximum levels at 24 hours. After 3 days, the majority of primary spermatocytes were absent in most tubular stages, a finding that corroborates previous reports (Clark et al, 1997). Except for the robust labeling of pachytene spermatocytes, only a few other, isolated cells, identified as degenerating spermatogonia, could be discerned that were labeled by TUNEL. Similar images were obtained in testis analyzed at 5 and 7 days after administration of the toxicant. The apoptotic nature of this degeneration was also confirmed by the presence of the characteristic ladder pattern of DNA fragmentation in the testis of rats killed 24 after MAA treatment.

All results of the present investigation point to the fact that the short-term exposure of rats to MAA leads to the rapid increase in ERß protein and mRNA levels in pachytene spermatocytes destined to undergo apoptosis. The authenticity of the immunostaining results was confirmed using Western blot analysis of cytosolic and nuclear testicular extracts, using 2 distinct commercial antibodies, and, again, testicular cells treated with MAA rendered a more robust signal for cytoplasmic ERß than control cells. Taken together, these results are consistent with the interpretation that MAA action resulting in pachytene spermatocyte apoptosis entails the disruption of the normal expression levels and disposition of ERß in these cells.

These observations led us to pose 3 questions. First, does MAA directly and/or indirectly affect ERß levels, or are the effects mediated via other cells of the seminiferous tubules, possibly the Sertoli cell? Second, does MAA exhibit ERß activity? Third, does aberrant ERß exert a direct role in pachytene spermatocyte apoptosis? Regarding question 1, aside from data presented in the present article, there is no evidence either way to definitively settle this question in germ cells. Unfortunately, isolated pachytene spermatocytes do not withstand prolonged cultured conditions to rigorously test this hypothesis. Nevertheless, given our in vivo findings that both ERß mRNA and protein are elevated in afflicted pachytene spermatocytes, a reasonable conclusion is that MAA alters ERß levels in these cells. Whether it does so directly or via Sertoli cells, however, remains to be determined. Regarding question 2, we demonstrated that the addition of MAA at similar doses used in vivo (5 mmol/L) to HepG2 cells cotransfected with ERß and a luciferase reporter construct containing a consensus estrogen responsive element elicited a similar estrogenic activation as estradiol at 1 nmol/L concentration. Thus, these results confirm that MAA exhibits ERß activity, at least in a model system engineered to demonstrate this activity. Regarding question 3, ongoing experiments and evidence from the literature favor the interpretation that elevated levels of ERß are associated with germ cell apoptosis, especially given that we demonstrated here when it is located in the cytoplasm. First, in the present experiments, we observed repeatedly that significant ERß immunostaining was found in scattered, isolated germ cells undergoing degeneration in control testis, which possibly suggests that ERß has an active role in this step during normal spermatogenesis. Conversely, we showed that, in primary spermatocytes of seminiferous tubular stage VII, the stage where the germ cells are least at risk of degeneration in normal rats, TUNEL staining was absent and ERß was nearly impossible to detect in the MAA-treated rats (Kerr, 1992). Although ERß mRNA expression was found in stages VII-VIII of MAA-treated animals by microdissection, it is possible to speculate that this mRNA will be translated into protein at advanced stages and that the protein will accumulate in the stages found by immunohistochemistry. In addition, some of the ERß mRNA is certainly attributable to Sertoli cells, because no attempt was made to isolate by LCM germ cells that were free of Sertoli cells. An alternative explanation for the lack of correlation between the levels of mRNA and protein, however, may be the fact that the ERß protein could be more strictly regulated than the mRNA. In this regard, it has been shown that both ER{alpha} and ß (Alarid et al, 1999; Tschugguel et al, 2003) can be rapidly regulated via a proteasome-mediated pathway.

A second piece of evidence that associates ERß and apoptosis is the detection of a robust ERß immunoreactivity in degenerating pachytene spermatocytes in another model of primary spermatocyte apoptosis (unpubl. data), the androgen-binding protein transgenic mouse (Selva et al, 2000). Given this apparent association of enhanced ERß mRNA and protein with apoptotic pachytene spermatocytes, ongoing experiments using aromatase inhibitors will test directly whether the inhibition of P450 activity will produce a protective effect on MAA-induced apoptosis of pachytene spermatocytes. If our prediction holds true that aberrant ERß expression is intimately involved in pachytene spermatocyte apoptosis, then the inhibition of estrogenic activity, regardless of ERß levels after MAA treatment, should dramatically diminish pachytene spermatocyte apoptosis. In addition, other experiments will use antiestrogenic compounds to try and dissect out whether ERß involvement in apoptosis works via genomic effects or whether the cytoplasmic disposition of the receptor is indicating a nongenomic action heretofore unknown in the apoptotic process.

The enhanced cytoplasmic expression of ERß observed by immunohistochemistry and Western blot analysis, and our suggestion that it may be directly implicated in the apoptotic process, may appear to be in conflict with the ability of MAA to potentiate the genomic effects of estrogen detected in the transfection/promoter model system. As demonstrated in "Results," however, it is important to note that, even in the presence of enhanced cytoplasmic ERß expression, nuclear disposition of the receptor was present. Thus, it is possible that MAA does exert a genomic effect and that the enhanced cytoplasmic presence of the ERß is merely an inability of nuclear targeting of a steroid receptor in dying cells. Alternatively, as has been suggested for other nongenomic actions of steroid receptors (Beato and Klug, 2000; Moggs and Orphanides, 2001), perhaps it is now necessary to speculate that the enhanced expression of the ERß in the cytoplasm is associated with apoptosis.

Moreover, the functional studies demonstrating elevated levels of ERß with pachytene spermatocyte apoptosis described above are consistent with emerging concepts in the literature that link elevated ERß levels to cellular apoptosis. For example, estradiol was shown to function either as a neuroprotective agent or as an inducer of apoptosis in cultured neurons, depending on the estrogen receptor subtype present in the cell; ER{alpha} was a neuroprotective factor, but ERß acted as a mediator of apoptosis (Nilsen et al, 2000). Similar to our findings, ERß immunoreactivity was increased in the cytoplasm of degenerative hippocampal neurons in patients with Alzheimer disease (Savaskan et al, 2001) and in colonocytes of a cell line that lacked ER{alpha} expression (COLO205) and degenerated by apoptosis when the cells were treated with estradiol (Qiu et al, 2002). Conversely, ERß expression was diminished in conditions where cell survival was favored—breast, colon, ovarian, and prostate cancers (Leygue et al, 1998; Pujol et al, 1998; Foley et al, 2000; Iwao et al, 2000; Rutherford et al, 2000; Campbell-Thompson et al, 2001; Horvath et al, 2001; Pasquali et al, 2001; Roger et al, 2001) and ERßKO mice at 1 year of age develop lesions in their prostates similar to intraepithelial neoplasia (Weihua et al, 2002). All of these data support the hypothesis that ERß can act as a negative regulator of proliferation. In addition, because the immunohistochemical localization of the ERß seems to be different as a function of the specific domain recognized by each ERß antibody (Rosenfeld et al, 1998) and several forms of ERß have been described in testis (Makinen et al, 2001), it is possible that the induction of apoptosis depends on the specific ERß variant present in the cell.

In summary, although the normal expression of ERß in pachytene spermatocytes implicates its function in normal spermatogenic progression, clearly, whether the elevation of ERß message and protein levels under certain conditions is an epiphenomenon of apoptosis or a causative mediator merits further investigation. At the present time, the accumulating body of evidence seems to favor the interpretation that ERß is a direct participant in this process. Because, in general, endocrine disruptors have a high affinity for ERß, this action may help explain the fertility problems caused by a large number of chemical compounds exhibiting estrogenic activity.


   Footnotes
 
Supported by grants from the Ministerio de Educación y Ciencia, (PM98/0161, PM99/0134, and HI999-0067), Serono-Fundación Salud 2000, the Comisionat de Recerca-CIRIT (grant 1999/SGR00231), the National Institutes of Health (grant HD23484 to C.A.S.-Q., CA92984 to M.J., and DK48807 to D.P.M.), and an NRSA fellowship.

The authors thank Maria Pons (Anatomia Patològica, Hospital Vall d'Hebron, Barcelona) for her excellent technical assistance.


   References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Alarid ET, Bakopoulos N, Solodin N. Proteasome-mediated proteolysis of estrogen receptor: a novel component in autologous down-regulation. Mol Endocrinol. 1999; 13:1522-1534.[Abstract/Free Full Text]

Allan DJ, Harmon BV, Roberts SA. Spermatogonial apoptosis has three morphological recognizable phases and shows no circadian rhythm during normal spermatogenesis in the rat. Cell Prolif. 1992; 25:241-250.[Medline]

Bartlett JMS, Kerr JB, Sharpe RM. The selective removal of pachytene spermatocytes using methoxy acetic acid as an approach to the study in vivo of paracrine interactions in the testis. J Androl. 1988;9:31-40.[Abstract/Free Full Text]

Beato M, Klug J. Steroid hormone receptors: an update. Hum Reprod Update. 2000; 6:225-236.[Abstract/Free Full Text]

Blanco-Rodriguez J, Martínez-García C. Induction of apoptotic cell death in the seminiferous tubule of the adult rat testis: assessment of the germ cell types that exhibit the ability to enter apoptosis after hormone suppression by oestradiol treatment. Int J Androl. 1996;19:237-247.[Medline]

Brinkworth MH, Weinbauer GH, Schlatt S, Nieschlag E. Identification of male germ cells undergoing apoptosis in adult rats. J Reprod Fertil. 1995;105:25-33.

Campbell-Thompson M, Lynch IJ, Bhardwaj B. Expression of estrogen receptor (ER) subtypes and ERbeta isoforms in colon cancer. Cancer Res. 2001;61:632-640.[Abstract/Free Full Text]

Carreau S, Bourguiba S, Lambard S, Galeraud-Denis I, Genissel C, Levallet J. Reproductive system: aromatase and estrogens. Mol Cell Endocrinol. 2002;193:137-143.[Medline]

Carreau S, Levallet J. Cytochrome P450 aromatase in male germ cells. Folia Histochem Cytobiol. 1997; 35:195-202.[Medline]

Chomzinsky P, Sacchi N. Single step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline]

Clark AM, Maguire SM, Griswold MD Accumulation of clusterin/sulfated glycoprotein-2 in degenerating pachytene spermatocytes of adult rats treated with methoxyacetic acid. Biol Reprod. 1997;57:837-846.[Abstract]

Ebling FJ, Brooks AN, Cronin AS, Ford H, Kerr JB. Estrogenic induction of spermatogenesis in the hypogonadal mouse. Endocrinology. 2000; 141:2861-2869.[Abstract/Free Full Text]

Foley EF, Jazaeri AA, Shupnik MA, Jazaeri O, Rice LW. Selective loss of estrogen receptor beta in malignant human colon. Cancer Res. 2000;60:245-248.[Abstract/Free Full Text]

Foster PMD, Lloyd SC, Blackburn DM. Comparison of the in vivo and in vitro testicular effects produced by methoxy-, ethoxy- and N-butoxyacetic acids in the rat. Toxicology. 1987; 43:17-30.[Medline]

Henriksen K, Hakovirta H, Parvinen M. Testosterone inhibits and induces apoptosis in rat seminiferous tubules in a stage-specific manner: in situ quantification in squash preparations after administration of ethane dimethane sulfonate. Endocrinology. 1995; 136:3285-3291.[Abstract]

Horvath LG, Henshall SM, Lee CS, et al. Frequent loss of estrogen receptor-beta expression in prostate cancer. Cancer Res. 2001;61:5331-5335.[Abstract/Free Full Text]

Iwao K, Miyoshi Y, Egawa C, Ikeda N, Noguchi S. Quantitative analysis of estrogen receptor-beta mRNA and its variants in human breast cancers. Int J Cancer. 2000; 88:733-736.[Medline]

Janulis L, Bahr JM, Hess RA, Janssen S, Osawa Y, Bunick D. Rat testicular germ cells and epididymal sperm contain active P450 aromatase. J Androl. 1998;19:65-71.[Abstract/Free Full Text]

Kerr JB. Spontaneous degeneration of germ cells in normal rat testis: assessment of cell types and frequency during the spermatogenic cycle. J Reprod Fertil. 1992; 95:825-830.

Krishnamurthy H, Weinbauer GF, Aslam H, Yeung CH, Nieschlag E. Quantification of apoptotic testicular germ cells in normal and methoxyacetic acid-treated mice as determined by flow cytometry. J Androl. 1998;19:710-717.[Abstract/Free Full Text]

Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA. 1996; 93:5925-5930.[Abstract/Free Full Text]

Leblond CP, Clermont Y. Definition of the stages of the cycle of the seminiferous epithelium in the rat. Ann N Y Acad Sci. 1952;55:548-573.

Levallet J, Bilinska B, Mittre H, Genissel C, Fresnel J, Carreau S. Expression and immunolocalization of functional cytochrome P450 aromatase in mature rat testicular cells. Biol Reprod. 1998; 58:919-926.[Abstract/Free Full Text]

Leygue E, Dotzlaw H, Watson PH, Murphy LC. Altered estrogen receptor alpha and beta messenger RNA expression during human breast tumorigenesis. Cancer Res. 1998; 58:3197-3201.[Abstract/Free Full Text]

Macaya A, Munell F, Gubits RM, Burke RE. Apoptosis in substantia nigra following developmental striatal excitotoxic injury. Proc Natl Acad Sci USA. 1994;91:8117-8121.[Abstract/Free Full Text]

Makinen S, Makela S, Weihua Z, Warner M, Rosenlund B, Salmi S, Hovatta O, Gustafsson JK. Localization of oestrogen receptors alpha and beta in human testis. Mol Hum Reprod. 2001; 7:497-503.[Abstract/Free Full Text]

Moggs JG, Orphanides G. Estrogen receptors: orchestrators of pleiotropic cellular responses. EMBO Rep. 2001; 9:775-781.

Nilsen J, Mor G, Naftolin F. Estrogen-regulated developmental neuronal apoptosis is determined by estrogen receptor subtype and the Fas/Fas ligand system. J Neurobiol. 2000; 43:64-78.[Medline]

Nitta H, Bunick D, Hess RA, et al. Germ cells of the mouse testis express P450 aromatase. Endocrinology. 1993; 132:1396-1401.[Abstract]

O'Donnell L, Robertson KM, Jones ME, Simpson ER. Estrogen and spermatogenesis. Endocr Rev. 2001; 22:289-318.[Abstract/Free Full Text]

Park TR, Lynch GR, Tsai PS. Estrogen accelerates gonadal recrudescence in photo-regressed male Siberian hamsters. Endocrinol. 2002; 143:4131-4134.[Abstract]

Pasquali D, Rossi V, Esposito D, Abbondanza C, Puca GA, Bellastella A, Sinisi AA. Loss of estrogen receptor beta expression in malignant human prostate cells in primary cultures and in prostate cancer tissues J Clin Endocrinol Metab. 2001; 86:2051-2055.[Abstract/Free Full Text]

Pentikainen V, Erkkila K, Suomalainen L, Parvinen M, Dunkel L. Estradiol acts as a germ cell survival factor in the human testis in vitro. J Clin Endocrinol Metab. 2000; 85:2057-2067.[Abstract/Free Full Text]

Pujol P, Rey JM, Nirde P, Roger P, Gastaldi M, Laffargue F, Rochefort H, Maudelonde T. Differential expression of estrogen receptor-alpha and -beta messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res. 1998; 58:5367-5373.[Abstract/Free Full Text]

Qiu Y, Waters CE, Lewis AE, Langman MJ, Eggo MC. Oestrogen-induced apoptosis in colonocytes expressing oestrogen receptor beta. J Endocrinol. 2002;174:369-377.[Abstract]

Reventos J, Munell F. Transgenic animal models in reproductive endocrine research. Eur J Endocrinol. 1997; 136:566-580.[Medline]

Robertson KM, O'Donnell L, Jones ME, et al. Impairment of spermatogenesis in mice lacking a functional aromatase (cyp 19) gene. Proc Natl Acad Sci USA. 1999; 96:7986-7991.[Abstract/Free Full Text]

Roger P, Sahla ME, Makela S, Gustafsson JA, Baldet P, Rochefort H. Decreased expression of estrogen receptor beta protein in proliferative preinvasive mammary tumors. Cancer Res. 2001; 61:2537-2541.[Abstract/Free Full Text]

Rosenfeld CS, Ganjam VK, Taylor JA, Yuan X, Stiehr JR, Hardy MP, Lubahn DB. Transcription and translation of estrogen receptor-beta in the male reproductive tract of estrogen receptor-alpha knock-out and wild-type mice. Endocrinology. 1998; 139:2982-2987.[Abstract/Free Full Text]

Rutherford T, Brown WD, Sapi E, Aschkenazi S, Munoz A, Mor G. Absence of estrogen receptor-beta expression in metastatic ovarian cancer. Obstet Gynecol. 2000; 96:417-421.[Abstract/Free Full Text]

Sassone-Corsi P. Transcriptional checkpoints determining the fate of male germ cells. Cell. 1997; 88:163-166.[Medline]

Saunders PTK, Fisher JS, Sharpe RM, Millar MR. Expression of oestrogen receptor beta (ERß) occurs in multiple cell types, including some germ cells, in the rat testis. J Endocrinol. 1998; 156:R13-R17.[Abstract]

Savaskan E, Olivieri G, Meier F, Ravid R, Muller-Spahn F. Hippocampal estrogen beta-receptor immunoreactivity is increased in Alzheimer's disease. Brain Res. 2001; 908:113-119.[Medline]

Selva DM, Hogeveen KN, Seguchi K, Tekpetey F, Hammond GL. A human sex hormone-binding globulin isoform accumulates in the acrosome during spermatogenesis. J Biol Chem. 2002; 277:45291-45298.[Abstract/Free Full Text]

Selva DM, Tirado OM, Toran N, Suárez-Quian CA, Reventos J, Munell F. Meiotic arrest and germ cell apoptosis in androgen-binding protein transgenic mice. Endocrinology. 2000; 141:1168-1177.[Abstract/Free Full Text]

Suárez-Quian CA, Goldstein SR, Bonner RF. Laser capture microdissection: a new tool for the study of spermatogenesis. J Androl. 2000;21:601-608.[Medline]

Suárez-Quian CA, Martinez-Garcia F, Nistal M, Regadera J. Androgen receptor distribution in adult human testis. J Clin Endocrinol Metab. 1999;84:350-358.[Abstract/Free Full Text]

Tirado OM, Martinez ED, Rodriguez OC, Danielsen M, Selva DM, Reventos J, Munell F, Suárez-Quian CA. Methoxyacetic acid disregulation of androgen receptor and androgen-binding protein expression in adult rat testis. Biol Reprod. 2003; 68:1437-1446.[Abstract/Free Full Text]

Tschugguel W, Dietrich W, Zhegu Z, Stonek F, Kolbus A, Huber JC. Differential regulation of proteasome-dependent estrogen receptor alpha and beta turnover in cultured human uterine artery endothelial cells. J Clin Endocrinol Metab. 2003; 88:2281-2287.[Abstract/Free Full Text]

Van Pelt AM, de Rooij DG, van der Burg B, van der Saag PT, Gustafsson JA, Kuiper GG. Ontogeny of estrogen receptor-beta expression in rat testis. Endocrinology. 1999; 140:478-483.[Abstract/Free Full Text]

Weihua Z, Warner M, Gustafsson J. Estrogen receptor beta in the prostate. Mol Cell Endocrinol. 2002; 193:1-5.[Medline]

Weiss M, Vigier M, Hue D, Perrard Sapori MH, Marret C, Avallet O, Durand P. Pre- and postmeiotic expression of male germ cell specific genes throughout 2 week co-cultures of germinal and Sertoli cells. Biol Reprod. 1997;57:68-76.[Abstract]

Woolveridge I, de Boer-Brouwer M, Taylor MF, Teerds KJ, Wu FC, Morris ID. Apoptosis in the rat spermatogenic epithelium following androgen withdrawal: changes in apoptosis-related genes. Biol Reprod. 1999;60:461-470.[Abstract/Free Full Text]

Zirkin BR, Santulli R, Awoniyi CA, Ewing LL. Maintenance of advanced spermatogenic cells in the adult rat testis: quantitative relationship to testosterone concentration within the testis. Endocrinology. 1989; 124:3043-3049.[Abstract]




This article has been cited by other articles:


Home page
Biol. Reprod.Home page
M. G. Wade, A. Kawata, A. Williams, and C. Yauk
Methoxyacetic Acid-Induced Spermatocyte Death Is Associated with Histone Hyperacetylation in Rats
Biol Reprod, May 1, 2008; 78(5): 822 - 831.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. M. Tabb and B. Blumberg
New Modes of Action for Endocrine-Disrupting Chemicals
Mol. Endocrinol., March 1, 2006; 20(3): 475 - 482.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. G. Wade, R. Poon, N. Li, A. Lee, A. McMahon, and I. Chu
Testicular Toxicity of Candidate Fuel Additive 1,6-Dimethoxyhexane: Comparison with Several Similar Aliphatic Ethers
Toxicol. Sci., January 1, 2006; 89(1): 304 - 313.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. M. Selva, O. M. Tirado, N. Toran, C. A. Suarez-Quian, J. Reventos, and F. Munell
Estrogen Receptor {beta} Expression and Apoptosis of Spermatocytes of Mice Overexpressing a Rat Androgen-Binding Protein Transgene
Biol Reprod, November 1, 2004; 71(5): 1461 - 1468.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
C. A Oliveira, G. A B Mahecha, K. Carnes, G. S Prins, P. T K Saunders, L. R Franca, and R. A Hess
Differential hormonal regulation of estrogen receptors ER{alpha} and ER{beta} and androgen receptor expression in rat efferent ductules
Reproduction, July 1, 2004; 128(1): 73 - 86.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Munell, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Munell, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS