| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the * Centre de Recherche en Biologie de la
Reproduction and the Département
d'Obstétrique-Gynécologie, Faculté de Médecine,
Université Laval, Ste-Foy, Québec, Canada.
| Correspondence to: Dr Robert Sullivan, Unité d'Ontogénie-Reproduction, Centre de Recherche, Centre Hospitalier de l'Université Laval, 2705 Boul Laurier, Ste-Foy, Québec, Canada G1V 4G2 (e-mail robert.sullivan{at}crchul.ulaval.ca). |
| Received for publication August 4, 2003; accepted for publication September 11, 2003. |
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Key words: Gene expression, sperm maturation
Since the 1960s, vasectomy has been performed in nearly 100 million men for family planning purposes (Weiske, 2001). The consequences of vasectomy (excurrent duct obstruction) on the human epididymis are not well known (McDonald, 1996, 2000), most likely because the different animal models used to study vasectomy's effects on the male reproductive tract give varying results between species and even between individuals (Bedford, 1976). Accompanying the increased popularity of vasectomy has been an increased demand for surgical vasectomy reversal (vasovasostomy). The surgical success of vasovasostomy, when evaluated by recovery of normal spermogram values, can reach 85%; however, fertility recovery is much lower (Sharlip, 1993). The difficulty in regaining fertility after successful vas deferens reanastomosis can be attributed to female partner infertility, to antisperm antibodies, to epididymal obstruction by granuloma, or to idiopathic epididymal dysfunction (Silber, 1989; Belker et al, 1991; Nieschlag et al, 1997).
Our laboratory had previously described a human sperm protein, P34H, proposed to be involved in sperm binding to the egg's zona pellucida (Boué et al, 1994, 1996; Sullivan, 1999). This protein is synthesized and secreted by principal cells of the corpus epididymidis, and its location on spermatozoa is restricted to the sperm surface covering the acrosomal cap (Légaré et al, 1999). We have previously shown that P34H is always present on spermatozoa of fertile men and absent in approximately 50% of men presenting with idiopathic infertility (Boué and Sullivan, 1996). This protein can thus be considered a marker of sperm epididymal maturation in humans (Sullivan, 1999). Interestingly, P34H is also absent in a high proportion of normospermic vasovasostomized men (Guillemette et al, 1999). In situ hybridization analysis of P34H messenger RNA (mRNA) distribution showed that following vasectomy, the P34H mRNA is no longer expressed in the corpus epididymidis, its expression being shifted to the proximal caput epididymidis (Légaré et al, 2001). It thus appears that under vasectomy, the expression pattern of this gene involved in sperm maturation is modified along the human epididymis, and this can affect sperm maturation. Vasectomy has also been shown to affect expression of the cysteine-rich secretory protein (CRISP-1) in the rat caput epididymidis (Turner et al, 1999) and of the HE2-like mRNA in the corpus segment of the cynomolgus monkey (Doiron et al, 2003).
Gene expression along the epididymis is highly orchestrated, each region being characterized by a specific pattern of protein secretion. It appears that vasectomy provokes disregulation of gene expression along the excurrent duct. Understanding how vasectomy affects the epididymis may give some clues as to how gene expression is regulated along the excurrent duct. To further document the effects of vasectomy on the pattern of gene expression along the human epididymis, 3 transcripts previously shown to be expressed by human epididymis were selected with regard to their different pattern of expression: HE1, HE2, and HE5 (Kirchhoff, 1999). Even though its expression is not specific to the epididymis, HE1 was chosen because it is the most abundant gene product expressed in all the epididymal segments, excluding the most proximal part containing the efferent ducts (Krull et al, 1993). HE2 was chosen because of its expression in the distal human caput epididymidis. By opposition to HE2, HE5 mRNA was studied because it is mainly expressed in principal cells of the distal part of the epididymis. In situ hybridization and immunohistochemistry analysis were used to investigate the expression pattern of these 3 specific epididymal mRNA and proteins.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
In Situ Hybridization
HE (complementary DNAs)—
All complementary DNA (cDNA) inserts were generated by reverse
transcriptase-polymerase chain reaction (RT-PCR) using poly(A)RNA from normal
human epididymis. The oligonucleotide sequences used for primers were for HE1
(5' GATGGAGTTATAAAGGAAGT and 5' GCTGGAGGTGCTGTCAAGAG), for HE2
(5' GCAGTGCTCTTGGCAGACAT and 5' GCAACACCTATTCCAGGGAT), and for HE5
(5' GACAGCCACGAAGATCCTAC and 5' TGCAGTACAAGGGTAACTTT). All PCR
products were subcloned into pGEM-T (Promega, Madison, Wis). All nucleotide
sequences were determined by the dideoxinucleotide termination method (Sanger)
using a T7 Sequenase v 2.0 kit (Amersham, Baie d'Urfée, Québec,
Canada).
RNA Labeling— RNA probes were transcribed using the Digoxigenin RNA labeling technique for in vitro transcription (Roche Diagnostics, Laval, Québec, Canada). Briefly, plasmids were digested with appropriate restriction endonucleases downstream from the target DNA insert. mRNA was transcribed using SP6 and T7 RNA polymerase (Roche) in the presence of Digoxigenin-11-uridire-triphosphate (DIG)-UTP.
Fixation and Pretreament of Sections— Epididymis cryosections were fixed with freshly prepared 4% (wt/vol) paraformaldehyde in PBS for 5 minutes at room temperature, incubated for 10 minutes in 95% ethanol/5% acetic acid at -20°C, and rehydrated in successive baths of decreasing concentrations of ethanol diluted with diethylpyrocarbonate (DEPC)-treated water. Target RNAs were unmasked by enzymatic digestion with 10 µg/mL proteinase K (Roche) in PBS for 10 minutes at 37°C and then incubated for 5 minutes in 0.2% glycine. Sections were postfixed for 5 minutes with 4% paraformaldehyde in PBS, acetylated with 0.25% acetic anhydride, 0.1 M triethanolamine, pH 8.0, for 10 minutes, and finally washed with PBS.
Hybridization— Tissues were prehybridized for 2 hours at 42°C, with 250 µg/mL salmon sperm DNA preheated in a hybridization solution (0.3 M NaCl, 0.01 M Tris-HCl, pH 7.5, 1 mM EDTA, and 1x Denhardt solution) (0.2% [wt/vol] Ficoll 400, 0.2% [wt/vol] polyvinylpyrrolidone, 0.2% [wt/vol] bovine serum albumin [BSA], 5% dextran sulfate, 0.02% sodium dodecyl sulfate, and 50% formamide). Sections were then incubated overnight at 42°C, under coverslips, with 25 µL of 5 µg/mL heat-denatured antisense or sense HE1, HE2, or HE5 chromosomal RNA (cRNA) probed with DIG (Roche) according to supplier's instructions. Sections were washed twice in 2x SSC at room temperature, and this was followed by two 10-minute washes at 42°C in 2x SSC, 1x SSC, and 0.2x SSC.
Immunodectection— Hybridization reactions were detected by immunostaining with alkaline phosphatase-conjugated DIG antibodies (Roche). Nonspecific staining was blocked by preincubation for 1 hour with 5% (vol/vol) heat-inactivated sheep serum in Tris-HCl/NaCl buffer (0.2 M Tris-HCl, 0.2 M NaCl, and 0.3% Triton X-100). Sections were then incubated for 2 hours at room temperature with the alkaline phosphatase-conjugated anti-DIG antibodies diluted 1:1000 in blocking solution, washed with Tris-HCl/NaCl buffer, and incubated with 0.1 M Tris-HCl, pH 9.5, 0.1 M NaCl, and 0.01 M MgCl2. The hybridization signal was visualized after a 10- to 15-minute incubation period with the phosphatase substrate, nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolylphosphate p-toluidine salt (GIBCO-BRL, Gaithersburg, Md). Levamisole (2 mM; Sigma Chemical Co, St Louis, Mo) was added to the reaction mixture to inhibit endogenous alkaline phosphatase. Microscopic slides were immersed in 1 mM EDTA and 10 mM Tris-HCl, pH 7.5, washed 5 minutes in H2O, counterstained with neutral red, dehydrated through baths of ethanol, cleared in xylene, and mounted with Permount (Fisher Scientific, Nepean, Ontario, Canada). Epididymis sections from control and vasectomized men were processed in parallel to allow comparison.
Antibodies
Rabbit polyclonal antibody against ram HE1/CTP (human epididymal
1/cholesterol transfert protein) was a kind gift of Dr Jean-Luc Gatti
(Fouchecourt et al, 2000) and
used at a 7500-fold dilution for immunostaining. Rabbit polyclonal antibodies
directed against 2 peptides (P3 and P4) synthesized according to the HE2 cDNA
sequences were a kind gift of Dr Christiane Kirchhoff. Anti-P3
(HE2
/HE2ß-specific) and P4 (HE2ß1/HE2E-specific) antisera
reacting with 2 different HE2 isoforms
(von Horsten et al, 2002) were
used at a 200-fold dilution. Rat monoclonal antibody against human-CD52
antigen (CAMPATH-1) was purchased from Cederlane (Hornby, Ontario, Canada) and
used at a 25-fold dilution. Biotinylated goat anti-rabbit secondary antibody
was obtained from Dako Diagnostics (Mississauga, Ontario, Canada), and
biotinylated goat anti-rat secondary antibody was purchased from Jackson
Immunoresearch Laboratories (West Grove, Pa).
Immunohistochemical Staining
Cryostat cross sections (10 µm) were prepared from frozen epididymal
tissues. Endogenous peroxidase activity was quenched with 3%
H2O2 (vol/vol) in PBS for 30 minutes. Nonspecific
binding sites were then blocked with 10% goat serum in PBS for 1 hour. The
HE1-, HE2-, or CD52-specific antibodies were diluted in PBS and applied
overnight at 4°C. In control sections, the primary antibodies were
replaced by the corresponding nonspecific immunoglobulin G (IgG) or preimmune
serum (rabbit IgG for HE1 or preimmune serum for HE2 and rat IgG for CD52) and
processed in parallel. Sections were subsequently incubated with biotinylated
goat anti-rabbit or goat anti-rat secondary antibody for 30 minutes and with
avidin-biotin complex reagent for 30 minutes. Immunostaining was shown using
3-amino-9-ethylcarbazole (AEC). Harris hematoxylin was used for
counterstaining and mounted under a coverslip using an aqueous mounting medium
(Sigma). Slides were observed under a Zeiss Axioskop2 Plus microscope
(Toronto, Ontario, Canada) linked to a digital camera from Diagnostics
Instruments (Sterling Heights, Mich). Images were captured using the Spot
software (Diagnostics) and analyzed with Image-Pro Plus from Media Cybernetics
(Silver Springs, Md).
Image Analysis
All experiments were performed on specimens at least 3 times that included
normal epididymis control sections. Five images per section were digitalized.
Areas of interest were separately cropped and then submitted to densitometry
analysis for quantification as already described by Doiron et al
(2003). Color-cube-based
segmentation was used to select only shades of blue (in situ hybridization) or
red (immunohistochemistry) in the area of interest. Integrated optical density
(IOD) of the blue or the red staining was measured after standard OD
calibration. Results were expressed in OD units. All data were presented as
mean (±SEM). Statistical analysis was performed by analysis of variance
using super ANOVA software (ABACUS Concepts, Berkeley, Calif). Results were
compared by the Student-Newman-Keuls test. Differences were considered
significant at P-values <.05.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
To identify the presence of HE1 protein in the epididymides of normal and vasectomized men, immunohistochemistry analysis was carried out using a polyclonal anti-HE1 antibody (Figure 2). As previously described, HE1 protein was detectable in large amounts within the epithelium of the normal human caput, corpus, and cauda epididymides (Kirchhoff et al, 1996). HE1 staining was more intense in the cytoplasm at the apical side of the epithelium. Following vasectomy, the presence of HE1 protein along the epididymis was greatly altered; the staining intensity was tremendously decreased (Figure 2). No reactivity was observed when preimmune serum was used as a negative control (Figure 2G and H).
|
Expression Patterns of HE2 and HE5 mRNAs and Proteins
The tissue distribution of human HE2 and HE5 mRNAs in the epididymides of
normal and vasectomized men was investigated by using a PCR fragment of 359
and 421 bp, respectively (showing 100% identity with HE2 and HE5 cDNAs)
(Kirchhoff et al, 1993;
Osterhoff et al, 1994), as in
situ probes. In contrast to HE1, vasectomy did not affect the distribution or
the level of HE2 and HE5 mRNA expression along the human epididymis (Figures
3 and
4). In both normal and
vasectomized epididymal tissues, HE2 transcript was expressed in the caput
epididymal epithelium. By contrast, HE5 mRNA was predominantly expressed by
the epithelial cells of the corpus epididymidis. Both transcripts were
predominant in the basal cytoplasm compartment of the principal cells. In all
in situ hybridizations performed, no positive signal was observed in the
interstitial epididymal tissues. Nor was any signal detected when HE2 or HE5
sense cRNA probes were used as negative controls
(Figure 3G and H;
Figure 4G and H).
|
|
Immunohistologic techniques were used to document the distribution of HE2 and HE5 translational products and the possible effect of vasectomy on their respective localization. As for the transcripts, the protein distribution along the epididymides was not affected by vasectomy. When probed with the anti-P4 peptide antiserum (HE2ß1/HE2E-specific), the major peptide isoform in the human epididymis, HE2 was strongly detectable in the cytoplasm of the caput and corpus epididymal epithelium with some labeling in the intraluminal compartment (Figure 5). Similar results were obtained when immunohistologic staining of HE2 was performed using the antiserum raised against the P3 peptide (data not shown). In both intact and vasectomized epididymides, HE5 was uniformly distributed within the cytoplasm of the human epididymal principal cells as described by Kirchhoff et al (1993). The staining signal was more intense in the corpus epididymidis (Figure 6C and D). For both HE2 and HE5 immunodetection, no signal was detectable when preimmune sera or control IgGs were used as negative controls (Figure 5G and H; Figure 6G and H).
|
|
In Situ Hybridization and Immunohistochemistry Quantification
Highly reproducible image analysis software was used to quantify HE
expression (Doiron et al,
2003). Densitometric quantification of in situ hybridization and
immunohistologic staining clearly indicated that, by opposition to HE2 and
HE5, only HE1 transcriptional and translational products were affected by
vasectomy. When compared to values characterizing normal epididymides, HE1
mRNA and protein were significantly diminished under vasectomy, with
P-values <.05 (Figure
7).
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
Some modifications in mRNA and protein synthesis that occur after vasectomy persist after successful vasovasostomy. In the rat, vasectomy affects the overall pattern of protein synthesis and secretion in the caput epididymidis, including CRISP-1 (Turner et al, 1999). The reduction in CRISP-1 secretion in the caput lumen persists following successful vasovasostomy (Turner et al, 2000). Because it is involved in the mechanism of sperm-egg plasma membrane fusion, CRISP-1 is a critical protein in sperm maturation (Cuasnicu et al, 1999). P34H is a human epididymal protein involved in the acquisition of the ability to interact with the zona pellucida by the maturing spermatozoa (Boué et al, 1994). Whereas the pattern of P34H mRNA expression along the epididymis is altered in vasectomized men, this protein is absent on the spermatozoa of an important percentage of normospermic vasovasostomized men (Guillemette et al, 1999), and the absence of P34H has been associated with male infertility (Boué and Sullivan, 1996; Sullivan, 1999). The amounts of HE1 mRNA and protein are dramatically decreased under vasectomy. Whether or not HE1 levels remain low following vas deferens reanastomosis in vasectomized men is unknown. After ejaculation, HE1 seems to be present in the seminal plasma, but only loosely bound to sperm (Kirchhoff et al, 1996). HE1 sequence shows similarity with a protein purified from ram epididymal fluid (Baker et al, 1993; Okamura et al, 1999) as well as with the NPC2 gene (Ko et al, 2003). These have been shown to function as cholesterol-transfer proteins. Therefore, HE1 may represent a decapacitation factor that regulates the cholesterol content of sperm during maturation, storage, and capacitation (Kirchhoff et al, 1997). In this regard, it would be interesting to compare the cholesterol content of spermatozoa from normal and vasovasostomized men. As for P34H, HE1 could thus be a good indicator of the epididymal sequelae remaining after vasovasostomy in men.
The 3 HE mRNAs and proteins investigated in this study have been selected according to their different expression pattern along the epididymis. HE2 and HE5 were previously reported to be expressed in the proximal and distal regions of the normal human epididymis, respectively (Krull et al, 1993; Kirchhoff, 1999). Our data are in accordance with these reports and show that vasectomy does not affect the level of transcription or the distribution of these epididymal mRNAs. On the other hand, HE1, which shows its maximum expression in the median region of the epididymis, is greatly affected by vasectomy. Like HE1, P34H, which is strongly expressed in the corpus epididymis, is also affected by vasectomy (Légaré et al, 2001). This may suggest that the median region of the epididymis is more "sensitive" to modifications triggered by vasectomy than the proximal caput and distal cauda epididymides. This appears to be the case in cynomolgus monkeys, a species in which vasectomy down-regulates HE2 expression in the corpus region (Doiron et al, 2003). On the other hand, caput epididymidis protein secretion is greatly affected by vasectomy in the rat (Turner et al, 2000). Obviously, epididymal sequelae following vasectomy show species-related differences (Bedford, 1976). Another possibility is that some genes are more responsive to intraluminal changes occurring under vasectomy than others. During vasectomy in man, the height of epididymal epithelium is greatly decreased (Légaré et al, 2001). This is a consequence of the increased intraluminal pressure (Johnson and Howards, 1975) caused by the local accumulation of fluid. Another consequence of fluid accumulation is the modification of lumicrine factor composition of testicular origin (Turner et al, 1999). The consequences for the epithelial functions could be represented by the observed modifications of synthesis and secretion of specific proteins such as HE1 or P34H (Figure 8). The molecular mechanisms responsible for these specific changes remain to be determined. Understanding how vasectomy affects the epididymis will contribute to further comprehension of the control mechanisms of gene expression along the excurrent duct in men.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Bedford JM. Adaptations of the male reproductive tract and the fate of spermatozoa following vasectomy in the rabbit, rhesus monkey, hamster and rat. Biol Reprod. 1976; 14:118-142.[Abstract]
Belker AM, Thomas AJ Jr, Fuchs EF, Konnak JW, Sharlip ID. Results of 1,469 microsurgical vasectomy reversals by the Vasovasostomy Study Group. J Urol. 1991;145:505-511.[Medline]
Boué F, Berube B, De Lamirande E, Gagnon C, Sullivan R. Human sperm-zona pellucida interaction is inhibited by an antiserum against a hamster sperm protein. Biol Reprod. 1994; 51:577-587.[Abstract]
Boué F, Blais J, Sullivan R. Surface localization of P34H, an epididymal protein, during maturation, capacitation, and acrosome reaction of human spermatozoa. Biol Reprod. 1996; 54:1009-1017.[Abstract]
Boué F, Sullivan R. Cases of human infertility are associated with the absence of P34H, an epididymal sperm antigen. Biol Reprod. 1996; 54:1018-1024.[Abstract]
Cooper TG. In defense of a function for the human epididymis. Fertil Steril. 1990; 54:965-975.[Medline]
Cooper TG. Interactions between epididymal secretions and spermatozoa. J Reprod Fertil. 1998; 53(suppl):119-136.
Cornwall GA, Hann SR. Specialized gene expression in the
epididymis. J Androl. 1995; 16:379-383.
Cuasnicu P, Cohen D, Ellerman D. Participation of epididymal protein "DE" and its egg binding sites in sperm-egg fusion. In: Gagnon C, ed. The Male Gamete: From Basic to Clinical Applications. Vienna, Ill: Cache River Press; 1999:267-272.
Dacheux J, Dacheux F. Protein secretion in the epididymis. In: Hinton IBRaB, ed. The Epididymis. New York, NY: Kluwer Academic/Plenum Publishers; 2002:151-168.
Doiron K, Légaré C, Saez F, Sullivan R. Effect of
vasectomy on gene expression in the epididymis of cynomolgus monkey.
Biol Reprod. 2003; 68:781-788.
Fouchecourt S, Metayer S, Locatelli A, Dacheux F, Dacheux JL.
Stallion epididymal fluid proteome: qualitative and quantitative
characterization; secretion and dynamic changes of major proteins.
Biol Reprod. 2000; 62:1790-1803.
Guillemette C, Thabet M, Dompierre L, Sullivan R. Some
vasovasostomized men are characterized by low levels of P34H, an epididymal
sperm protein. J Androl. 1999; 20:214-219.
Hamilton DW. Anatomy of mammalian male accessory reproductive organs. In: Lamming G, ed. Marshall's Physiology of Reproduction. Edinburg, United Kingdom: Churchill-Livingstone; 1990 : 691-746.
Hermo L, Oko R, Morales CR. Secretion and endocytosis in the male reproductive tract: a role in sperm maturation. Int Rev Cytol. 1994;154:106-189.[Medline]
Johnson AL, Howards SS. Intratubular hydrostatic pressure in testis
and epididymis before and after vasectomy. Am J
Physiol. 1975;228:556-564.
Kirchhoff C. Molecular characterization of epididymal proteins. Rev Reprod. 1998; 3:86-95.[Abstract]
Kirchhoff C. Gene expression in the epididymis. Int Rev Cytol. 1999;188:133-202.[Medline]
Kirchhoff C, Krull N, Pera I, Ivell R. A major mRNA of the human epididymal principal cells, HE5, encodes the leucocyte differentiation CDw52 antigen peptide backbone. Mol Reprod Dev. 1993; 34:8-15.[Medline]
Kirchhoff C, Osterhoff C, Young L. Molecular cloning and characterization of HE1, a major secretory protein of the human epididymis. Biol Reprod. 1996; 54:847-856.[Abstract]
Kirchhoff C, Pera I, Derr P, Yeung CH, Cooper T. The molecular biology of the sperm surface. Post-testicular membrane remodelling. Adv Exp Med Biol. 1997; 424:221-232.[Medline]
Ko DC, Binkley J, Sidow A, Scott MP. The integrity of a
cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control
lysosome cholesterol levels. Proc Natl Acad Sci U S A. 2003; 100:2518-2525.
Krull N, Ivell R, Osterhoff C, Kirchhoff C. Region-specific variation of gene expression in the human epididymis as revealed by in situ hybridization with tissue-specific cDNAs. Mol Reprod Dev. 1993;34:16-24.[Medline]
Légaré C, Gaudreault C, St-Jacques S, Sullivan R.
P34H sperm protein is preferentially expressed by the human corpus
epididymidis. Endocrinology. 1999; 140:3318-3327.
Légaré C, Thabet M, Picard S, Sullivan R. Effect of
vasectomy on P34H messenger ribonucleic acid expression along the human
excurrent duct: a reflection on the function of the human epididymis.
Biol Reprod. 2001; 64:720-727.
McDonald SW. Vasectomy review: sequelae in the human epididymis and ductus deferens. Clin Anat. 1996; 9:337-342.[Medline]
McDonald SW. Cellular responses to vasectomy. Int Rev Cytol. 2000;199:295-339.[Medline]
Nieschlag A, Behre H, Engelmann U, Hertle L. Male contribution to contraception. In: Nieschlag E, Behre HM, eds. Male Reproductive Health and Dysfunction. Berlin: Springer; 1997:377-393.
Okamura N, Kiuchi S, Tamba M, et al. A porcine homolog of the major secretory protein of human epididymis, HE1, specifically binds cholesterol. Biochim Biophys Acta. 1999; 1438:377-387.[Medline]
Osterhoff C, Kirchhoff C, Krull N, Ivell R. Molecular cloning and characterization of a novel human sperm antigen (HE2) specifically expressed in the proximal epididymis. Biol Reprod. 1994; 50:516-525.[Abstract]
Robaire B, Hermo L. Efferent ducts, epididymis and vas deferens: structure, functions and their regulation. In: Knobil E, O'Neill J, eds. The Physiology of Reproduction. 1st ed. New York, NY: Raven Press; 1988: 999-1080.
Rodriguez CM, Kirby JL, Hinton BT. Regulation of gene transcription in the epididymis. Reproduction. 2001; 122:41-48.[Abstract]
Schoysman RJ, Bedford JM. The role of the human epididymis in sperm maturation and sperm storage as reflected in the consequences of epididymovasostomy. Fertil Steril. 1986; 46:293-299.[Medline]
Sharlip ID. What is the best pregnancy rate that may be expected from vasectomy reversal? J Urol. 1993; 149:1469-1471.[Medline]
Silber SJ. Pregnancy after vasovasostomy for vasectomy reversal: a
study of factors affecting long-term return of fertility in 282 patients
followed for 10 years. Hum Reprod. 1989; 4:318-322.
Sullivan R. Interaction between sperm and epididymal secretory proteins. In: Gagnon C, ed. The Male Gamete: From Basic to Clinical Applications. Vienna, Ill: Cache River Press; 1999:93-104.
Turner TT. On the epididymis and its role in the development of the
fertile ejaculate. J Androl. 1995; 16:292-298.
Turner TT, Riley TA, Mruk DD, Cheng CY. Obstruction of the vas
deferens alters protein secretion by the rat caput epididymidal epithelium in
vivo. J Androl. 1999; 20:289-297.
Turner TT, Riley TA, Vagnetti M, Flickinger CJ, Caldwell JA, Hunt DF. Postvasectomy alterations in protein synthesis and secretion in the rat caput epididymidis are not repaired after vasovasostomy. J Androl. 2000;21:276-290.[Abstract]
von Horsten HH, Derr P, Kirchhoff C. Novel antimicrobial peptide of
human epididymal duct origin. Biol Reprod. 2002; 67:804-813.
Weiske WH. Vasectomy. Andrologia. 2001; 33:125-134.[Medline]
This article has been cited by other articles:
|
|
 |
|
  V. Thimon, G. Frenette, F. Saez, M. Thabet, and R. Sullivan Protein composition of human epididymosomes collected during surgical vasectomy reversal: aproteomic and genomic approach Hum. Reprod., May 14, 2008; (2008) den181v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Lavers, D. J. Swanlund, B. A. Hunter, M. L. Tran, J. L. Pryor, and K. P. Roberts Acute Effect of Vasectomy on the Function of the Rat Epididymal Epithelium and Vas Deferens J Androl, November 1, 2006; 27(6): 826 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Legare, M. Thabet, J.-L. Gatti, and R. Sullivan HE1/NPC2 status in human reproductive tract and ejaculated spermatozoa: consequence of vasectomy Mol. Hum. Reprod., July 1, 2006; 12(7): 461 - 468. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
