Journal of Andrology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kleiman, S. E.
Right arrow Articles by Simon, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kleiman, S. E.
Right arrow Articles by Simon, A. J.
Journal of Andrology, Vol. 24, No. 5, September/October 2003
Copyright © American Society of Andrology

Reduced Human Germ Cell-Less (HGCL) Expression in Azoospermic Men With Severe Germinal Cell Impairment

SANDRA E. KLEIMAN*, LEAH YOGEV*, EINAV NILI GAL-YAM{ddagger}, RON HAUSER*, RONNI GAMZU*, AMNON BOTCHAN*, GEDALIA PAZ*, HAIM YAVETZ*, BATIA BAR-SHIRA MAYMON{dagger}, LETIZIA SCHREIBER{dagger}, SHLOMIT BARZILAI{ddagger}, NINETTE AMARIGLIO{ddagger}, GIDEON RECHAVI{ddagger} AND AMOS J. SIMON{ddagger},§

From the * Institute for the Study of Fertility, Lis Maternity Hospital, {dagger} Institute of Pathology, Tel Aviv Sourasky Medical Center, and {ddagger} Pediatric Hemato-Oncology Department, Division of Hematology, Chaim Sheba Medical Center, Tel-Hashomer, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel. § Present address: Immunology and Allergy, Department of Pediatrics, Infection, Immunity, Injury and Repair Program, Research Institute, The Hospital for Sick Children and the University of Toronto, Toronto M5G 1X8, Canada.

Correspondence to: Dr S. E. Kleiman, Institute for the Study of Fertility, Lis Maternity Hospital, Tel Aviv Sourasky Medical Center, 6 Weizman St, Tel Aviv 64239, Israel (e-mail: ser{at}tasmc.health.gov.il).
Received for publication February 10, 2003; accepted for publication April 28, 2003.

   Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Germ cell-less (GCL) protein is a nuclear envelope protein highly conserved between the mammalian and Drosophila orthologues. In Drosophila, maternal GCL protein is required to establish the germ lineage during embryonic development. In mammals, it is suggested that the GCL function is mainly in spermatogenesis and that it might be related to the ability of mouse GCL to repress transcription. Using reverse transcriptase-polymerase chain reaction analyses, we investigated the role of human GCL (HGCL) in spermatogenesis by studying its expression in the testicular tissue of 67 azoospermic men with normal karyotype and no Y-chromosome microdeletion. Their testicular biopsy specimens underwent meticulous histological and cytological analysis as well as molecular analysis with various markers of spermatogenesis (RBM1, DAZ, and CDY1). The rate of X-Y and 18 chromosome bivalent formation during meiosis was additionally assessed in 22 of these biopsy specimens and correlated to HGCL expression. Expression of HGCL was affected in parallel with the severity of testicular impairment found. Defective sperm motility was associated with the absence of HGCL. Nevertheless, the absence of HGCL expression did not influence the normal process of chromosome bivalent formation in meiosis. Our results suggest that HGCL is not essential for the chromosomal events of meiosis but might be involved in later aspects of spermatogenesis.

     Key words: Testicular HGCL expression, markers of spermatogenesis, spermatogenesis impairments, motility impairments, HGCL and chromosome bivalent formation



Impairment in fertility affects 1 in 25 men (Cram et al, 2001), and the underlying causal factors are unknown in most of them. It is currently believed that idiopathic infertility is mainly of genetic origin. Thus, the study of genes that are involved in the control of spermatogenesis may help to elucidate and distinguish between intrinsic and acquired male infertility.

One gene with a potential role in human fertility is germ cell-less (GCL). The GCL protein was first described in Drosophila melanogaster as a crucial factor in embryonic germ cell development (Jongens et al, 1992, 1994). It was shown that Drosophila females with reduced GCL function give rise to sterile adult progeny that lack germ cells. Drosophila with a {Delta}gcl genotype is associated with impaired spermatogenesis due to the failure to establish transcription quiescence necessary for the proper formation of germ cell precursors (Robertson et al, 1999; Leatherman et al, 2002).

Mouse and human orthologues of Drosophila GCL (mGCL, HGCL, and dGCL, respectively) were recently cloned and characterized (de la Luna et al, 1999; Kimura et al, 1999; Nili et al, 2001a). An important feature of all GCL proteins is the presence of an evolutionary conserved BTB/POZ (broad-complex, tram track, and bric-abrac/poxvirus and zinc finger) domain. This domain is an evolutionarily conserved protein-protein interaction domain often found in developmentally regulated genes (Godt et al, 1993; Bardwell and Treisman, 1994; Zollman et al, 1994). It is strongly implicated in the regulation of gene expression through oligomerization and interaction with cofactors, ultimately leading to chromatin remodeling and changes in gene expression (review by Collins et al, 2001).

mGCL was found to be expressed in low levels at the primordial germ cells and highly expressed in the adult mouse, mainly at the pachytene spermatocyte stage (Kimura et al, 1999; Leatherman et al, 2000). This protein rescued the dGCL null phenotype, indicating that mGCL is a functional orthologue of dGCL (Leatherman et al, 2000). mGCL was demonstrated to interact with the DP3{alpha} component of the E2F-DP heterodimer transcription factor, an interaction that was found to repress the transcriptional activity of the E2F complex. This repression is thought to be mediated through anchoring of the E2F complex to the nuclear envelope, possibly through LAP2ß, a nuclear envelope protein that also binds GCL (de la Luna et al, 1999; Nili et al, 2001b). Furthermore, overexpression of mGCL was suggested to cause the accumulation of cells in the G1 phase, suggesting that it has properties of a negative cell-cycle regulator (de la Luna et al, 1999).

The HGCL gene was recently isolated and mapped to chromosome 2p13. HGCL expression is not ubiquitous, and the highest levels of messenger RNA were detected in the testis (Nili et al, 2001a).

Given the involvement of mGCL in spermatogenesis, the present study focused on the role of HGCL in human spermatogenesis and, particularly, at meiosis. The expression of the HGCL gene in testicular biopsy specimens of azoospermic men who were grouped according to their histologic and cytologic findings was evaluated. To overcome the nonhomogeneous nature of the testis, expression of HGCL was also correlated to that of germ cell-specific genes (RBM, DAZ, and CDY1), denoting the presence of germ cells in the biopsy specimen used for RNA extraction. In addition, the expression of HGCL was correlated to meiosis normality as measured by the rate of meiotic bivalent formation in spermatocytes.


   Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
A total of 67 azoospermic men undergoing the testicular sperm extraction procedure consented to a genetic evaluation. Only men with a normal karyotype and no Y-chromosome azoospermia factor (AZF) microdeletion were included. The institutional review board committee approved the study in accordance with the Helsinki Declaration of 1975.

Testicular Tissue Evaluation

One biopsy specimen from each testis was divided into 3 pieces: 2 small pieces (approximately 5 mg each) were taken, one for histopathological analysis and the other for RNA isolation. The third portion of the biopsy (approximately 50 mg) was minced for spermatozoa isolation to be used in the intracytoplasmic sperm injection (ICSI) process. In 22 cases, an additional small piece was minced, fixed, and further analyzed by fluorescence in situ hybridization (FISH) for meiosis evaluation (Yogev et al, 2000). Two additional biopsy specimens from other locations were taken from each testis for spermatozoa extraction only in almost all cases (Hauser et al, 1998).

Quantitative Analysis and Classification of Testicular Biopsy Specimens

Histological examination was performed on Bouin's fixed paraffin-embedded biopsy specimens after staining with hematoxylin-eosin. The most advanced spermatogenetic cell that was identified determined the histological definition. The terms mature spermatid and spermatozoa were used for histological and minced biopsy specimen detection, respectively. Normal spermatogenesis in azoospermic men was classified by the mean number of mature spermatids per tubule according to the classification proposed by Silber et al (1997). At least 20 seminiferous tubules were scored in each specimen. The presence of spermatozoa in minced testicular tissue was assessed as previously described (Ben-Yosef et al, 1999). Sperm motility was qualitatively judged in each biopsy specimen immediately after mincing and at 30-minute intervals of incubation up to 2 hours.

Four groups were established according to the combined findings of histological and cytological examination of the 3 biopsy specimens taken from the respective testis. The control group included 19 biopsy specimens from men with a normal number of mature spermatids per tubule (>17 sperm cells per tubule; Silber et al, 1997) by histological analysis. Fourteen of them were from male carriers of cystic fibrosis mutations/5T polymorphism combined with congenital absence of the vas deferens. The hypospermatogenesis group included 23 men in which at least one biopsy specimen contained spermatozoa or mature spermatids. The spermatocyte maturation arrest group (10 biopsy specimens) was characterized by the absence of spermatozoa or mature spermatids in all locations of both testes. The Sertoli cells only group included 15 men in which an absolute absence of germ cells was found in all biopsy specimens.

The mean ± SE follicular stimulating hormone values in the normal spermatogenesis, hypospermatogenesis, spermatocyte maturation arrest, and Sertoli cell only groups were 5.7 ± 1.4, 19.24 ± 2.6, 16.3 ± 3.3, and 20 ± 2 mIU/mL, respectively.

Genetic Evaluation

Karyotype and Y-chromosome microdeletion tests were performed on peripheral lymphocytes. Chromosome analysis was performed by the G-banding chromosome staining technique. The Y-chromosome AZF microdeletion test was performed by multiplex polymerase chain reaction (PCR) with genomic DNA as previously described (Kleiman et al, 1999).

Testicular biopsy specimens from one testis (left or right) of each man was frozen in liquid nitrogen immediately after having been dissected and cryopreserved until RNA isolation. Total RNA was extracted after homogenization by the High Pure RNA Tissue kit (Roche, Mannheim, Germany), and 10 µL of the extract was used for complementary DNA (cDNA) synthesis with AMV reverse transcriptase (Roche) and oligo-dT15. The oligonucleotide primer sets for CDY1 minor, DAZ, RBM, and ß-actin were previously described (Kleiman et al, 2001). The oligonucleotide primers set for the detection of HGCL expression (GCL-up CTATTACACATCAGCAGGGAC and GCL-down CTTGAGGCCCCACCTCACTGTCC) were designed from the published sequence accession XM_031592. These primer sets for HGCL, CDY1 minor, DAZ, and RBM gave differential PCR products for cDNA and genomic DNA. The same PCR product for cDNA and genomic DNA was obtained with ß-actin primers. In view of this observation, RNA samples were tested with and without the reverse transcriptase (RT) step to verify that there was no genomic DNA contamination. The expression of ß-actin was evaluated as an internal control for the quality of the RNA isolation and efficiency of the RT-PCR method. A positive control (cDNA from the castrated man) and blank controls were included in each PCR run. Whenever PCR results were negative in 2 independent reactions, RT and PCR steps were redone.Go



View larger version (33K):
[in this window]
[in a new window]
 
Human germ cell-less (HGCL) messenger RNA expression in testicular biopsy specimens analyzed by reverse transcriptase-polymerase chain reaction. 1 indicates blank; 2 and 3, normal spermatogenesis; 4 and 5, Sertoli cells only; 6 and 7, spermatocyte maturation arrest; 8 to 10, hypospermatogenesis; +RT, mixture with reverse transcriptase; -RT, mixture without reverse transcriptase; and std, 100-bp ladder standard.

 

Meiotic Evaluation

Spermatocyte evaluation with triple-color FISH analysis using centromeric DNA probes for chromosomes X, Y, and 18 (Vysis, Downers Grove, Ill) was performed (Yogev et al, 2000). The rate of bivalent formation was scored as previously described (Yogev et al, 2002). Generally, at least 350 primary spermatocytes were analyzed in each specimen, according to statistical calculations for the required sample size. The FISH technique used for bivalent evaluation had certain advantages over other techniques mainly because it facilitates the evaluation of meiosis, even in pathological cases with an extremely low number of spermatocytes that reflect serious testicular damage (Metzler-Guillermain and Guichaoua, 2000).

Statistical Analysis

The association between the groups with various impairments of spermatogenesis (determined by the combined results of the histological and cytological evaluations) and the presence of HGCL expression was checked using the Pearson {chi}2 test. Fisher's exact test was performed to assess the significance of the relationship between the presence of expression of HGCL and the spermatogenic impairment. The significance of HGCL association to the overall expression of DAZ, RBM, and CDY1 and to the normal motility of sperm cells was assessed by the same test. Pearson's test was performed to assess the correlation between percentage of biopsy specimens with the spermatozoa and chromosomes bivalent formation rate. The difference in the percentage of chromosome bivalents formation between groups expressing and not expressing HGCL was calculated by the t test.


   Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
RNA Expression Analysis of HGCL in Testicular Biopsy Specimens With Various Impairments of Spermatogenesis

Since HGCL is suggested to play a role in spermatogenesis, the correlation between its expression and various spermatogenic impairments was assessed. The RT-PCR results in the designated groups (ie, normal spermatogenesis, hypospermatogenesis, spermatocyte maturation arrest, and Sertoli cell only) are shown in the Figure and are summarized in Table 1. The expression of HGCL tested by RT-PCR was detected at variable ratios in the different groups (Table 1). A significant association between certain groups and expression of HGCL was found (P = .026). HGCL was expressed at a significantly higher rate in specimens in which spermatozoa were detected (normal and hypospermatogenesis groups) compared with specimens with no spermatozoa (P = .032). HGCL expression was also detected at higher rate in specimens containing germ cells (normal, hypospermatogenesis, and maturation arrest groups) compared with those with depleted germ cells (Sertoli cell only group) (P = .029). The most significant difference was between groups with normal spermatogenesis vs Sertoli (somatic) cell only (P = .003). The association between either germ cell (DAZ, RBM) or haploid germ cell (CDY1) molecular markers and the HGCL expression was significant (P = .021, P = .021, and P = .004, respectively).


View this table:
[in this window]
[in a new window]
 
Table 1. Gene expression results of testicular biopsy specimens with varied impairments of spermatogenesis
 

Characteristics of Biopsy Specimens With Impairment of HGCL Expression

Specimens with hypospermatogenesis showed significant differences in the sperm motility between HGCL-expressing and non-HGCL-expressing ones (P = .039). Although motility is difficult to assess when performing ICSI, testicular specimens with weakly motile, nonmotile, or a low percentage of motile spermatozoa were clearly detected among 6 (75%) of 8 men in the hypospermatogenesis group with the absence of HGCL expression. These findings were different from men in the same group who expressed HGCL, among whom only 4 (27%) of 15 had motility impairments. Yet, there were 2 biopsy specimens from the normal group with no detectable HGCL who had normal sperm motility and morphology.

HGCL Expression and Chromosome Bivalents Formation in Spermatocytes

As a transcription repressor expressed mainly at the pachytene spermatocytes in mouse, GCL might regulate meiosis. We therefore tested for a possible correlation between HGCL expression and meiosis bivalent formation in the testicular biopsy specimens. Table 2 depicts individual results of the bivalent formation rate of homologous chromosomes X-Y and 18, the HGCL expression findings, and the presence of testicular spermatozoa in at least 1 of the 3 biopsy samples of the testis. There was a significantly higher rate of bivalent formation of homologous chromosomes (both X-Y and 18) wherever spermatozoa were found in at least one location of the testis (Pearson correlation, P < .001). The rate of chromosome bivalent formation was not affected by the presence or absence of HGCL expression (Table 2). The rate of bivalent X-Y chromosomes (mean ± SE) was 66.8 ± 6.43 and 75 ± 9.52 in the groups with and without GCL expression, respectively, and the rate of 18 chromosome bivalent was 87.1 ± 4.26 and 91 ± 5.71, respectively.


View this table:
[in this window]
[in a new window]
 
Table 2. Individual results of biopsy specimens studied for meiotic impairments*
 


   Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The HGCL gene was variably expressed in biopsy specimens with different impairments of spermatogenesis. The extent of its expression was in parallel to the severity of the spermatogenetic impairment, as indicated by the most advanced stage of the germ line. Defective sperm motility was significantly associated with the absence of HGCL expression.

A significant association between HGCL expression in the testis and the presence of germ cells or mature spermatid or spermatozoa was demonstrated. The detection of HGCL expression in 40% of the biopsy specimens with Sertoli cell only was intriguing, because its homologous mouse gene mGCL was detected in germ cells but not in somatic (eg, Sertoli) cells of the testis (Kimura et al, 1999; Leatherman et al, 2000). It is possible that HGCL expression might reflect abnormal events in the somatic cells of the testis. Studies using immunohistochemical analysis with anti-HGCL antibodies may clarify these findings. Unfortunately, polyclonal anti-mGCL antibodies did not work on paraffin-embedded human testicular biopsy specimens, so the possibility that HGCL expression might serve as a marker for testicular abnormalities could not be tested.

Patients with germinal failure might have minute foci of spermatogenesis sparse throughout the entire testis (Silber et al, 1997). Side by side, different histological and minced tissue findings such as Sertoli-cell-only and complete spermatogenesis might be detected in such patients. In view of the nonhomogeneous nature of the testis, we compared the expression of HGCL to the expression of DAZ, RBM1, and CDY1 minor genes within the same biopsy specimen. This was done in view of the fact that expression of DAZ and RBM1 confirms the presence of spermatogenetic cells (Menke et al, 1997; Elliot et al, 1998, Lee et al, 1998; Bar-Shira Maymon et al, 2001), whereas CDY1 minor, expressed in spermatids, reflects the presence of haploid germ cells (Kleiman et al, 2001; Lahn et al, 2002). The expression of HGCL correlates with that of DAZ, RBM1, and CDY1 minor. Nevertheless, exceptions were detected, suggesting that HGCL expression is more frequently impaired compared with the other markers tested. Further mutation analysis of the HGCL gene might help to clarify the source of the impairment, either mutations on the gene or impaired regulation of gene expression.

It was estimated that approximately 2000 different genes are involved in a variety of testicular functions, including testicular development, germ cell differentiation, meiosis, and spermiogenesis (Bhasin et al, 1998), suggesting that the genetic basis of male infertility might be highly heterogeneous. We classified our biopsy specimens based on the overall histological and cytological testicular findings: these groups could include subgroups with different unknown mutations that lead to similar impairment, a feature that might complicate the interpretation of our results.

Most biopsy specimens with spermatozoa were found to express HGCL, and defective sperm motility was observed very frequently whenever no HGCL was expressed, suggesting that HGCL might be involved in the regulation of differentiation during spermiogenesis. Larger numbers of patients and a quantitative analysis of motility would be needed to test this assumption. Many factors might influence the testicular sperm motility detected. However, the recently published findings in mgcl-1-null male mice model support our observation (Kimura et al, 2003). Structural abnormalities, decrease of sperm motility, and reduction of path velocity of motile sperm were observed in mgcl-1-null male mice.

Recent studies performed on transfected H1299 cells have reported an intrinsic and additive ability of mGCL to repress transcription (Nili et al, 2001b). Other proteins (eg, LAP2ß) might compensate for the absence of GCL in certain cells or under specific circumstances and might explain the lack of critical impairments of spermatogenesis found whenever HGCL was absent.

Lessons from other species (mice, flies, etc) are usually helpful in understanding human infertility in general and for the function of HGCL in particular. Studies on mGCL suggested that GCL might play a role in cell cycle, particularly at meiosis (de la Luna et al, 1999, Kimura et al, 1999; Leatherman et al, 2000). No particular difference, however, was observed in the rate of X-Y and 18 chromosome bivalents in spermatocytes between biopsy specimens that expressed or failed to express HGCL, suggesting that HGCL was not involved or, at least, was not essential in the normal process of chromosome bivalent formation during meiosis. Recently, it was published that the first abnormality observed during spermatogenesis in mgcl-1-null male mice was abnormal nuclear envelope structure in spermatocytes, affecting the appropriate nuclear-laminar organization. This in turn is essential for normal sperm morphogenesis and chromatin remodeling during spermiogenesis (Kimura et al, 2003).

In conclusion, HGCL by itself seems to play a minor role in spermatogenesis, probably during spermiogenesis. HGCL expression was affected mainly when spermatogenesis was dramatically impaired. It did not appear to be involved in men with a prominent meiotic impairment. HGCL does not seem to be essential for spermatozoa production: it might merely affect the overall normal spermatogenesis process and spermiogenesis in a specific way, by influencing the activity of genes that are directly involved in these processes.


   Acknowledgments
 
The authors thank Tovi Morad for her excellent technical assistance, Esther Eshkol for editorial assistance, and Ilana Galernter for the expert statistical analysis.


   Footnotes
 
Supported by grant 4823 from the Chief Scientific Office, Ministry of Health (Israel).


   References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Bardwell VJ, Treisman R. The POZ domain: a conserved protein-protein interaction motif. Genes Dev.1994;14:1664-1677.

Bar-Shira Maymon B, Elliott DJ, Kleiman SE, et al. The contribution of RNA-binding motif (RBM) antibody to the histopathologic evaluation of testicular biopsies from infertile men. Hum Pathol. 2001; 32:36-41.[Medline]

Ben-Yosef D, Yogev L, Hauser R, et al. Testicular sperm retrieval and cryopreservation prior to initiating ovarian stimulation as the first line approach in men with non-obstructive azoospermia. Hum Reprod. 1999;14:1794-1801.[Abstract/Free Full Text]

Bhasin S, Ma K, Sinha I, Limbo M, Taylor WE, Salehian B. The genetic basis of male infertility. Endocrinol Metab Clin North Am. 1998;27:783-805.[Medline]

Collins T, Stone JR, Williams AJ. All in the family: the BTB/POZ, KRAB, and SCAN domains. Mol Cell Biol. 2001; 21:3609-3615.[Free Full Text]

Cram DS, O'Bryan MK, De Kretser DM. Male infertility genetics—the future. J Androl. 2001; 22:738-746.[Medline]

de la Luna S, Allen KE, Mason SL, La Thangue NB. Integration of a growth-suppressing BTB/POZ domain protein with the DP component of the E2F transcription factor. EMBO J. 1999; 18:212-228.[Medline]

Elliott DJ, Oghene K, Makarov G, Makarova O, Hargreave TB, Chandley AC, Eperon IC, Cooke HJ. Dynamic changes in the subnuclear organization of pre-mRNA splicing proteins and RBM during human germ cell development. J Cell Sci. 1998; 111:1255-1265.[Abstract]

Godt D, Couderc JL, Cramton SE, Laski FA. Pattern formation in the limbs of Drosophila: bric a brac is expressed in both a gradient and a wave-like pattern and is required for specification and proper segmentation of the tarsus. Development. 1993; 119:799-812.[Abstract/Free Full Text]

Hauser R, Botchan A, Amit A, et al. Multiple testicular sampling in non-obstructive azoospermia—is it necessary? Hum Reprod. 1998;13:3081-3085.[Abstract/Free Full Text]

Jongens TA, Ackerman LD, Swedlow JR, Jan LY, Jan YN. Germ cellless encodes a cell type-specific nuclear pore-associated protein and functions early in the germ-cell specification pathway of Drosophila. Genes Dev. 1994; 15:2123-2136.

Jongens TA, Hay B, Jan LY, Jan YN. The germ cell-less gene product: a posteriorly localized component necessary for germ cell development in Drosophila. Cell. 1992; 21:569-584.

Kimura T, Ito C, Watanabe S, et al. Mouse germ cell-less as an essential component for nuclear integrity. Mol Cell Biol. 2003;23:1304-1315.[Abstract/Free Full Text]

Kimura T, Yomogida K, Iwai N, Kato Y, Nakano T. Molecular cloning and genomic organization of mouse homologue of Drosophila germ cell-less and its expression in germ lineage cells. Biochem Biophys Res Commun. 1999;262:223-230.[Medline]

Kleiman SE, Lagziel A, Yogev L, Botchan A, Paz G, Yavetz H. Expression of CDY1 may identify complete spermatogenesis. Fertil Steril. 2001;75:166-173.[Medline]

Kleiman SE, Yogev L, Gamzu R, Hauser R, Botchan A, Lessing JB, Paz G, Yavetz H. Genetic evaluation of infertile men. Hum Reprod. 1999;14:33-38.[Abstract/Free Full Text]

Lahn BT, Tang ZL, Zhou J, Barndt RJ, Parvinen M, Allis CD, Page DC. Previously uncharacterized histone acetyltransferases implicated in mammalian spermatogenesis. Proc Natl Acad Sci U S A. 2002; 99:8707-8712.[Abstract/Free Full Text]

Leatherman JL, Kaestner KH, Jongens TA. Identification of a mouse germ cell-less homologue with conserved activity in Drosophila. Mech Dev. 2000;92:145-153.[Medline]

Leatherman J, Levin L, Boero J, Jongens T. Germ cell-less acts to repress transcription during the establishment of the Drosophila germ cell lineage. Curr Biol. 2002; 12:1681-1685.[Medline]

Lee JH, Lee DR, Yoon SJ, Chai YG, Roh SI, Yoon HS. Expression of DAZ (deleted in azoospermia), DAZL1 (DAZ-like) and protamine-2 in testis and its application for diagnosis of spermatogenesis in non-obstructive azoospermia. Mol Hum Reprod. 1998; 4:827-834.[Abstract/Free Full Text]

Menke DB, Mutter GL, Page DC. Expression of DAZ, an azoospermia factor candidate, in human spermatogonia. Am J Hum Genet. 1997;60:237-241.[Medline]

Metzler-Guillemain C, Guichaoua MRG. A simple and reliable method for meiotic studies on testicular samples used for intracytoplasmic sperm injection. Fertil Steril. 2000; 74:916-919.[Medline]

Nili E, Cojocaru GS, Collin GB, Nishina PM, Brok-Simoni F, Amariglio N, Simon AJ, Rechavi G. The human germ cell-less (HGCL): a candidate gene for Alstrom syndrome. J Endocrinol Genet. 2001a; 2:29-35.

Nili E, Cojocaru GS, Kalma Y, et al. Nuclear membrane protein LAP2beta mediates transcriptional repression alone and together with its binding partner GCL (germ-cell-less). J Cell Sci. 2001b; 114:3297-3307.

Robertson SE, Dockendorff TC, Leatherman JL, Faulkner DL, Jongens TA. Germ cell-less is required only during the establishment of the germ cell lineage of Drosophila and has activities which are dependent and independent of its localization to the nuclear envelope. Dev Biol. 1999;215:288-297.[Medline]

Silber SJ, Nagy S, Devroey P, Tournaye H, Van Steirteghem AC. Distribution of spermatogenesis in the testicles of azoospermic men: the presence or absence of spermatids in the testes of men with germinal failure. Hum Reprod. 1997; 12:2422-2428.[Abstract/Free Full Text]

Yogev L, Gamzu R, Kleiman S, Botchan A, Hauser R, Yavetz H. Evaluation of meiotic impairment of azoospermic men by fluorescence in situ hybridization. Fertil Steril. 2000; 74:228-233.[Medline]

Yogev L, Gamzu R, Paz G, Kleiman S, Botchan A, Hauser R, Yavetz H. Rate of homologous chromosome bivalents in spermatocytes may predict completion of spermatogenesis in azoospermic men. Hum Genet. 2002;110:30-35.[Medline]

Zollman S, Godt D, Prive GG, Couderc JL, Laski FA. The BTB domain, found primarily in zinc finger proteins, defines an evolutionarily conserved family that includes several developmentally regulated genes in Drosophila. Proc Natl Acad Sci U S A. 1994; 25:10717-10721.




This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
E. Bonilla and E. Y. Xu
Identification and characterization of novel mammalian spermatogenic genes conserved from fly to human
Mol. Hum. Reprod., March 1, 2008; 14(3): 137 - 142.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. J.I. Ellis, E. J. Clemente, P. Ball, A. Toure, L. Ferguson, J. M.A. Turner, K. L. Loveland, N. A. Affara, and P. S. Burgoyne
Deletions on mouse Yq lead to upregulation of multiple X- and Y-linked transcripts in spermatids
Hum. Mol. Genet., September 15, 2005; 14(18): 2705 - 2715.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kleiman, S. E.
Right arrow Articles by Simon, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kleiman, S. E.
Right arrow Articles by Simon, A. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS