| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |

,||

,||
,||

,
,||
From the * Scott Department of Urology,
Departments of
Molecular and Cellular Biology,
Pathology, and
Medicine, Baylor College of Medicine; and||
Veterans Administration Medical Center, Houston
Texas.
| Correspondence to: Marco Marcelli, Department of Medicine, Baylor College of Medicine and VA Medical Center, 2002 Holcombe Blvd, Houston, TX 77030 (e-mail: marcelli{at}bcm.tmc.edu). |
| Received for publication July 11, 2002; accepted for publication September 16, 2002. |
| Abstract |
|---|
|
|
|---|
Key words: Androgen ablation, androgen receptor, CAG repeat, mutations, prostate cancer.
It is critical that we understand the molecular changes that lead tumor cells to resist hormonal ablation and to grow in an androgen-depleted environment. Because the androgen receptor (AR) mediates the effects of androgen on the development, growth, and differentiation of the prostate, AR abnormalities could explain why prostate cancer progresses to androgen-independent growth after AA. There is evidence that the AR is expressed in all stages of prostate cancer evolution, including prostatic intraepithelial neoplasia (Van-der-Kwast and Tetu, 1996), primary disease (Sadi et al, 1991; Tilley et al, 1994), and metastatic disease (Hobisch et al, 1995, 1996) before and after AA. Only a minority of cancers or cell lines are AR-negative (Tilley et al, 1990; Van-der-Kwast et al, 1991), and thus, even the "androgen-independent" tumors are AR-positive.
The following AR-related mechanisms are hypothesized to explain prostate cancer progression to androgen-independent growth: 1) amplification of the AR gene, which enhances AR function and tumor growth at subsaturating concentrations of the ligand (Visakorpi et al, 1995; Koivisto et al, 1997); 2) superactive ARs that result from point mutations (Buchanan et al, 2001); 3) a promiscuous mutant receptor protein that is activated by ligands other than androgen (Veldscholdte et al, 1990; Culig et al, 1993; Fenton et al, 1997; Tan et al, 1997); 4) inactivating mutations of AR that generate cancers with a malignant and aggressive phenotype (Nazareth et al, 1999); 5) signal transduction cross-talk with activation of growth-stimulating signaling pathways bypassing AR-regulated growth and differentiation (Voeller et al, 1991; Papandreou et al, 1998; Migliaccio et al, 2000; Kousteni et al, 2001); 6) changes in the response to stimulation by androgen due to the presence of polymorphisms of the polyglutamine (poly-Q) repeat of AR (Chamberlain et al, 1994; Kazemi-Esfarjani et al, 1995; Choong et al, 1996; Hakimi et al, 1997); 7) Changes in the intraprostatic bioavailability of dihydrotestosterone (DHT) to activate AR (Makridakis et al, 1997; Ross et al, 1998); 8) androgen-independent activation of AR (Nazareth and Weigel, 1996; Culig et al, 1998; Hobisch et al, 1998; Craft et al, 1999; Yeh et al, 1999; Wen et al, 2000); 9) modulation of AR signaling by changes in the availability of different coactivators or corepressors (Yeh and Chang, 1996; Miyamoto et al, 1998; Yeh et al, 1998; Gregory et al, 2001); and 10) overexpression of molecules such as caveolin, which influence AR sensitivity (Nasu et al, 1998)
"Outlaw estrogen receptors" identified in breast cancer (McGuire et al, 1991) raise the possibility that point mutations in the AR may account for progression from androgen-dependent to androgen-independent growth. Nevertheless, the frequency of AR mutations identified in prostate cancer is relatively low, although epidemiological studies of the prevalence of AR mutations in prostate cancer have not been formally undertaken. Seven hundred twenty-four cases of clinically detectable prostate cancer have been analyzed at the molecular level for the presence of AR mutations and 59 mutations (53 somatic mutations, 2 germ-line mutations, 4 changes of the poly-Q tract) were detected for an overall frequency of 8% (Newmark et al, 1992; Castagnaro et al, 1993; Culig et al, 1993; Suzuki et al, 1993, 1996; Gaddipati et al, 1994; Rizeveld de Winter et al, 1994; Shoenberg et al, 1994; Elo et al, 1995; Taplin et al, 1995, 1999; Visakorpi et al, 1995; Evans et al, 1996; Tilley et al, 1996; de Vere White et al, 1997; Koivisto et al, 1997; Paz et al, 1997; Wang and Uchida, 1997; Watanabe et al, 1997; Marcelli et al, 2000). It has been suggested that this apparently low prevalence of AR mutations in early stage prostate cancer reflects the limits of the technologies used, which are not sufficiently sensitive to detect the mutations. It is possible that prior to AA, only a few clones of prostate cancer cells have a mutated AR but these mutant clones are undetectable in the large pool of cells that express wild-type AR. Thus, these mutations would be undetectable by denaturing gradient gel electrophoresis and single-stranded conformational polymorphism (SCCP), which are characterized by a lower limit of mutation detection of >10% of affected cells.
AA induces apoptosis in cells that dependent on androgen for their survival. If clones of cells containing a mutant AR molecule are more likely to resist AA-induced apoptosis, they should accumulate in the tissue in response to AA. To test this, and to further evaluate the prevalence of AR mutations in primary specimens of advanced prostate cancer, we obtained archival tissue from 10 patients with stage D disease whose prostate cancers had been sampled before and after AA, and performed polymerase chain reaction (PCR)-SSCP and DNA sequence analysis of the AR. The results show that in selective cases, AA induces changes in the AR, and cause potentially important functional modifications.
| Materials and Methods |
|---|
|
|
|---|
|
Selection and Microdissection of the Specimens and Extraction of
Genomic DNA![]()
Only a minority of patients with metastatic prostate cancer undergo
invasive procedures to the prostate on more than one occasion, and this is the
reason why we could initially identify only 16 cases in whom the prostate had
been sampled before and after hormonal therapy. All these cases were found in
the tissue archive of the VA hospital. It was also important to minimize the
possibility of microdissecting different foci of cancer from the samples
obtained before and after AA. Therefore, among the specimens obtained after
AA, we selected 10 patients in whom a single neoplastic lesion was
histologically detectable, and we coupled that analysis with the needle biopsy
sample obtained before AA from the same patient, which also contained a unique
focus of cancer.
To enrich for tumor-derived DNA, each specimen was cut into 3 sections of 4, 25, and 4 µm. After hematoxylin and eosin staining, a pathologist identified the region containing 100% cancer in the two 4-µm sections. The 25 µm region located between the two adjacent sections containing 100% cancer was micro-dissected, deparaffined in xylene and ethanol, and precipitated by microcentrifugation at 4°C. Genomic DNA was extracted by digestion in a 100 µL volume (10 mM Tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% Tween-20, and 0.1 mg proteinase K) at 65°C for 2 hours, followed by denaturation of proteinase K at 95°C for 10 minutes, and by a final step of phenol-chloroform extraction. Depending on the final yield, 4 to 10 mL of genomic DNA was used in each PCR reaction.
PCR-SSCP![]()
PCR amplification of exons 28 of AR was performed using a Perkin
Elmer (Norwalk, Conn) Cetus thermal cycler and the same primers previously
reported (Marcelli et al,
1990,
2000) with the exception that
exon 4 was amplified using 2 sets of overlapping primers to generate products
within the acceptable range that maintains SSCP sensitivity. The primers used
for exon 4 were as follows: IV sense, TGATAAATTCAAGTCTCTCTTCCTT; IV antisense,
ACACACTACACCTGGCTCAATGGCTT; IVB sense, CAGTGTCACACATTGAAGGCTATGAA; and IVB
antisense, CACTAAATATGATCCCCCTTATCTC.
Eight sets of overlapping sense and antisense primers were used to amplify exon 1 (Marcelli et al, 2000). The PCR reaction involved denaturation at 100°C for 30 seconds, followed by 35 cycles of annealing and extension at 68°C for 90 seconds using 2.5 U of Taqara (Pan Vera Corporation, Madison WI), and 1 µL of 32[P]dCTP per reaction. The size and integrity of the PCR product, and the absence of contamination in the negative control sample (in which no DNA was added) were confirmed on 2% agarose gels. SSCP analysis was performed using methods described in published literature (Orita et al, 1989a,b; Thigpen et al, 1992). Briefly, 5 µL of PCR sample plus 20 µL of formamide loading dye (0.08% bromophenol blue, 0.08% xylene cyanol, 20 mM ethylenediamine tetraacetic acid [EDTA] in deionized formamide) and 20 mM NaOH were boiled for 10 minutes, snapfrozen in dry ice, and thawed before overnight electrophoresis. Six microliters of the above sample preparation was electrophoresed on a 6% nondenaturing polyacrylamide gel at 400 V for 1424 hours depending on the fragment size generated. A nondenatured wild-type AR control loaded in sucrose dye was electrophoresed in parallel with the other denatured samples to determine the mobility of the double-stranded DNA. As an internal control, each reaction was also loaded with a positive and a negative control to demonstrate our ability to detect a mutation (ie, with a PCR product generated from the genomic DNA of patients with testicular feminization who were known to have a wild-type or mutated sequence in exons 2 through 8). This genomic DNA was a generous gift from Dr M.J. McPhaul (University of Texas Southwestern Medical Center). Each of the positive control mutations used in this study has been characterized and published. After electrophoresis, the gels were dried and exposed to x-ray films for autoradiography. Normal controls were used in the PCR reactions for exon 1.
DNA Sequencing![]()
Stringent criteria were adopted to eliminate PCR artifacts. The presence of
a variant SSCP shift was confirmed in 3 independent PCR reactions. These PCR
products were further divided into 2 aliquots, one of which was run in an
agarose gel to verify the presence of the correct amplified product and the
absence of background in the negative control. The second aliquot was
TA-subcloned (Invitrogen, Carlsbad, CA) and sequenced using the Sequenase
sequencing kit (US Biochemical, Cleveland, OH) or using an automated
sequencing apparatus (Perkin Elmer sequencer 310). Each mutation was confirmed
from multiple clones (up to 20) obtained from at least 3 independent PCR
amplifications. The poly-G region of AR was not analyzed. AR amino acid
numbering reported in this paper is based on an assumed length of 919 amino
acids to be consistent with the AR mutation web site
(http://www.mcgill.ca/androgendb/data.htm).
In the middle of the execution of this study our laboratory purchased an
automatic sequencing instrument (Perkin Elmer sequencer 310). Sequence
analysis of the amplified products was carried out in parallel with SSCP
analysis for exons 28 of the 10 patients. Exon 1 could not be sequenced
with the automatic sequencing instrument because we had already completed its
SSCP analysis, and we did not have enough residual genomic DNA.
Construction of a Mutant AR Containing 26 Glutamines![]()
We recreated in vitro an AR complementary DNA (cDNA) containing the
mutation detected in patient F2 (ie, a poly-Q stretch containing 26
residues; see below). Insertion of an abnormal glutamine repeat in the frame
of an AR cDNA can be performed by digesting the wild-type construct with the
restriction endo-nucleases NarI and AflII (at positions 313
and 617, respectively) (McPhaul et al,
1991) that surround the poly-Q repeat and are unique cutters in
our AR expression plasmid CMV-AR (Tilley
et al, 1989). Due to the poor quality of the genomic DNA isolated
from patient F2 and to the inherent difficulties in amplifying the
CAG repeat, we were unable to obtain the segment of DNA between NarI
and AflII in a single PCR reaction. This segment of DNA was amplified
using 2 PCR reactions and the primers described below: primer I sense:
306 ACC TCC CGG CGC CAG TTT GCT GCT G 330 primer
II antisense: 510 TGA AGG TTG CTG TTC CTC ATC CAG CTT
AAG GTA GCC TGT GGG GCC TCT ACG ATG GGC TTG GGG 447 primer
III sense: 447 CCC CAA GCC CAT CGT AGA GGC CCC ACA GGC TAC
CTT AAG CTG GAT GAG GAA CAG CAA CCT TCA 511 primer
IV antisense: 686 CTG CTT AAG CCG GGG AAA GTG
G665 Primer I sense contains the unique NarI site of the
AR cDNA(boldface). Primer IV antisense contains the AflII site
present in the wild-type sequence (boldface). Primers II sense and III
antisense contain an artificial AflII site (italic) that was inserted
in position 480485 to allow the recreation of this expanded poly-Q
repeat using the two-step procedure described below. This artificial
AflII site inserts a V-108-K mutation in the amplified band.
Primers I sense and II antisense were used to amplify the genomic DNA of patient F2. The resulting fragment was cut with NarI and AflII and subcloned in the frame of CMV-AR that had been cut with the same restriction enzymes. The resulting construct, CMV-AR-Q26-1, was digested with AflII, and ligated with a PCR fragment obtained from the amplification of the DNA of patient F2 using primers III sense and IV antisense and cut with AflII. The resulting expression plasmid, CMV-AR-Q26-V108K, was sequenced to verify orientation and the absence of PCR artifacts, and was found to have 26 glutamines and the artificial AflII site mentioned above.
An AR containing the same V108K mutation in the background of a 20Q repeat (CMV-AR-Q20-V108K) was prepared to use as a control using the same approach. This construct was functionally characterized along with the wild-type AR and CMV-AR-Q26-V108K, and found to be indistinguishable from the wild-type receptor (not shown). We therefore were unable to create a CMV-AR-Q26 plasmid, and we assumed that it had the same transcriptional activity of CMV-AR-Q26-V108K based on the fact that CMV-AR-Q20-V108K and the wild-type CMV-AR-Q20 had the same transcriptional activity, and that the V108K mutation is outside the ligand or DNA binding domain, and this region of AR is not predicted to interact with known coactivators or corepressors of AR.
Stable Transfection of PC3 Cells![]()
PC3 cells are derived from prostate cancer and do not express AR
(Tilley et al, 1990). To study
the functional consequences of an amplified poly-Q tract on AR activity, PC3
cells were stably transfected using the technique previously described
(Marcelli et al, 1995). Briefly, 1 x 105 cells were seeded on day 0 and transfected
by polyfectamine on day 1 using 10 µg of CMV-AR, CMV-AR-Q20-V108K, or
CMV-AR-Q26-V108K and 1 µg of PSV2Neo
(Southern and Berg, 1982). By
pooling together colonies that are resistant to selection in 400 µg/mL of
G418 we obtained 10 cell lines. The cell lines (PC3-AR-3, PC3-Q20-2, and
PC3-Q26-5) showed the most intense immunoreactive AR by Western analysis
(Figure 4A), and were selected
to study the ligand binding characteristics of the various stably transfected
AR constructs, and their subcellular localization after addition of vehicle or
vehicle plus hormone.
|
Ligand Binding![]()
The ligand properties of the AR constructs stably transfected in PC-3 cells
were characterized in monolayer binding assays to determine the binding
capacity of 3[H]-DHT binding, and the apparent dissociation
constant (Kd) of the receptor, as previously described
(Tilley et al, 1989;
Nazareth et al, 1999).
Analysis of Transcriptional Activity![]()
Transient Transfection
COS-1 cells (1.25 x 105 cells per well in a 6-well plate)
were transfected by the nonrecombinant adenoviral-mediated DNA transfer
technique (Allgood et al, 1997)
using various concentrations of plasmids CMV-AR, CMV-AR-Q20-V108K, or
CMV-AR-Q26-V108K (see Figure
3), 0.5 µg of the androgen-inducible GRE2E1b-CAT
reporter (Allgood et al, 1993),
and 75 ng of plasmid CMV-ß-Gal. The plasmids were incubated with the
coupled virus (at a multiplicity of infection of 500:1) for 30 minutes.
Subsequently, additional poly-L-lysine (1.3 µg/µg of DNA) was added to
shrink the DNA onto the viral surface. The virus-DNA complex was added to the
cells and allowed to infect the cells for 2 hours in serum-free medium, after
which the medium was supplemented with charcoal-stripped serum to a final
concentration of 5%. Each experiment was performed a minimum of 3 times and
represents the mean ± SD of 3 replicates.
|
Twenty-four hours after transfection, the COS cells were treated with 1 nM R1881, or 0.2% ethanol vehicle (control), or as described in the individual procedures. After 24 hours of treatment, cells were harvested by scraping them into TEN buffer (40 mM Tris, 1 mM EDTA, and 150 mM NaCl pH 8.0), pelleted by centrifugation, and stored frozen until processed for ß-Gal and chloramphenicol acetyltransferase (CAT) assays.
ß-Gal and CAT AssaysCells were resuspended in 0.25 M Tris pH 7.5 and lysed by freeze-thawing. To measure ß-Gal activity, 5%10% of whole cell extract was incubated with 200 mg of IPTG in the presence of 0.1 M mercaptoethanol. The reaction was stopped by adding 0.2 M Na2CO3. The intensity of the color was determined at 420 nm using a Dynatech plate reader (Dynatech Technologies, Inc, Chantilly, Va). Volumes of whole cell extracts containing equivalent amounts of ß-Gal activity were assayed for CAT activity. CAT activity was determined with [3H] chloramphenicol (20 µCi/µmol)(Dupont NEN, Boston, Mass) and butyryl coenzyme A as previously described (Zhang et al, 1994). Acetylated chloramphenicol was extracted using a 2:1 mixture of tetramethyl pentadecane:xylene, and counted in a scintillation counter.
Western Blot Analysis![]()
Western blot analysis of AR was performed to screen stably transfected PC-3
cells to make sure they expressed an immunoreactive AR of the expected
molecular size, and transiently transfected COS cell to correct CAT activity
for amount of AR protein expressed in each well. Cells were harvested and
extracts were prepared in lysis buffer (250 mM Tris pH 8.0, 0.4 M NaCl) and
the protein concentration (in PC-3 cells) or ß-Gal activity (in COS
cells) was determined. Extract volumes equal to 20 µg of total protein (for
PC-3 cells) or 0.5 ß-Gal units (for COS cells) were electrophoresed on a
6.5% sodium dodecyl sulfate-poly-acrylamide gel electrophoresis (SDS-PAGE) and
transferred to nitrocellulose using a Bio-Rad (Hercules, Calif) liquid
transfer apparatus. The membrane was blocked with a solution of Tris-buffered
saline (TBS; 10 mM Tris, 150 mM NaCl pH 7.5) solution containing 3% bovine
serum albumin for 1 hour. The blot was incubated in 4 M urea for 2 hours,
washed extensively with TBST (TBS+ 0.1 % Tween-20), and incubated with anti-AR
antibody AR441 (Nazareth et al,
1999) overnight at 4°C. The blot was then washed with TBST 3
times and incubated with a secondary anti-mouse antibody (2:10 000 dilution)
for an hour, washed with TBST, and incubated in anti-rabbit horseradish
peroxidase (1:10 000) for an hour. The membrane was washed with TBST and the
signal was detected using an enhanced chemiluminescence kit from Amersham
(Piscataway, NJ).
Immunolabeling and Image Acquisition![]()
Stably transfected PC3-AR-3, PC3-Q20-2, and PC3-Q26-5 cells were grown in
F12 medium (Gibco BRL, Gaithersburg, Md) supplemented with 10% fetal bovine
serum. At the time of the experiment, cells were transferred to stripped
medium in the presence or absence of 5 nM R1881. At the indicated time points,
cells were fixed with a 4% paraformaldehyde solution in PEM buffer (80 mM
Pipes, 1 mM EDTA, and 1 mM MgCl2 pH 7.4), extracted with 0.5 %
Triton X-100 in PEM, and blocked with 5% milk in TBST (0.1 M Tris, 0.15 M
NaCl, 0.1 % Tween-20 pH 7.4). Cells were incubated with a monoclonal antibody
to AR (Nazareth et al, 1999) (1 µg/mL in TBST with 5% milk) for 2 hours, followed by incubation with
Alexa488 or Alexa568 conjugated goat anti-mouse secondary antibody (Molecular
Probes Inc, Eugene, Ore) diluted 1:600 in TBST with 5% milk for 1 hour. A
Z-series (0.2 µm steps) of optical sections was digitally imaged on a Delta
Vision Restoration Microscopy System (Applied Precision Inc, Issaquah, Wash)
and deconvolved using a constrained iterative algorithm to generate
high-resolution images. All image files were digitally processed for
presentation with Adobe Photoshop software (San Jose Calif). Shown in each
image is a single focal plane from typical cells.
HeLa cells were transiently transfected using the CaPO4 precipitation method with the CMV-AR, CMV-AR-Q20-V108K, or CMV-AR-Q26-V108K plasmids, and studied using the same experimental protocol.
| Results |
|---|
|
|
|---|
|
Patient E Sequence analysis showed a silent mutation in patient E (Figure 1B). This mutation consisted of the replacement of A768 with a glycine and resulted in conservation of glutamic acid residue 202. Because this mutation was detected in 100% of the templates before and after AA (E1 and E2) and in the normal surrounding tissue, we conclude that this patient was affected by a germ-line polymorphism, which in all likelihood does not carry functional consequences.
Patient D Patient D (Figure 1C) exhibited a clear SSCP variant in exon 2 before AA (D1). An extensive sequence analysis was performed. In 20 sequencing reactions obtained from D1 in 3 separate amplifications, we found 14 wild-type sequences and 8 irreproducible mutations. All 100% of 20 sequencing reactions from specimen D2 were wild-type. Because similar results were obtained in each amplification, we conclude that the DNA of this patient may have been damaged after the process of formalin fixation and paraffin embedding. Unfortunately, we cannot test this hypothesis by analyzing genomic DNA extracted from the benign tissue surrounding the lesion because sample D1 was from a needle biopsy containing 100% cancer. However, it is well documented in the literature that formalin fixation and paraffin embedding may damage the DNA of specimens (Shiao et al, 1997; Marcelli et al, 2000). Thus, extreme care should be applied when paraffin-embedded tissue is used to detect mutations.
Patient F The tissues of patient F (Figure 1D) showed a reproducible shift in the second segment of exon 1 in the DNA obtained after AA (F2). PCR analysis of the poly-Q tract showed that the band originating from the analysis of the genomic DNA of specimen F1 was larger than that of specimen F2 (Figure 2A). Sequence analysis showed an amplification of the glutamine repeat of exon 1 from 20 (before AA) to 26 (after AA) in 70% of the templates that were sequenced in F2 (Figure 2, B and C). Because 100% of the templates obtained from the normal surrounding tissue of F2 and from the cancer of F1 contained 20 glutamines, we concluded that this was a somatic mutation that arose following AA.
|
Functional Characterization of the ARQ26 Mutation![]()
Monolayer Binding
A 3[H]-DHT binding assay was performed in monolayers of
PC3-AR-3, PC3-Q20-2, and PC3-Q26-5. The 3 AR constructs expressed by these 3
cell lines (CMV-AR, CMV-AR-Q20-V108K, and CMV-AR-Q26-V108K) did not show
significant changes in the Kd for 3[H]-DHT
(Table 2). Although
Bmax varied somewhat (Table
2), all the cell lines we analyzed showed a reproducible ability
to bind 3[H]-DHT, and the observed variations are likely due to
differences in the plasmid insertion site, or copy numbers in the stably
transfected cells.
|
Analysis of Transcriptional Activation To determine whether AR containing 26 glutamines differs in its transcriptional activity from an AR with 20 repeats, the androgen-inducible GRE2E1b-CAT reporter was cotransfected into COS-1 cells together with CMV-AR-Q20-V108K or CMV-AR-Q26-V108K and plasmid CMV-ß-Gal. Cells were treated overnight with vehicle (ethanol), or the synthetic androgen R1881 (1 nM). As expected, there was a ligand-dependent induction of transcriptional activity (Figure 3A). A reproducible 30%50% decrease in transcriptional activity was detected in COS-1 cells transfected with CMV-AR-Q26-V108K compared with that when CMV-AR-Q20-V108K was used (Figure 3A). We performed a total of 6 experiments in triplicate, and the differences between CMV-AR-Q26-V108K compared to CMV-AR-Q20-V108K were 42%, 31%, 37%, 57%, 50%, and 33%. This was not a function of different expression of receptor protein because CAT activity was decreased when normalized for either transfection efficiency (Figure 3A) or receptor protein concentration (Figure 3B).
To confirm that the diminished activity was due to lower receptor activity and was not a result of differences in plasmid preparation, 2 independent plasmid preparations of both CMV-AR-Q20-V108K and CMV-AR-Q26-V108K were compared. As can be seen in Figure 3B, a reproducible decrease in receptor activity is observed in both plasmid preparations, confirming the reduced activity of CMV-AR-Q26-V108K. There was no significant difference in the amounts of transcriptional activity obtained with CMV-AR and CMV-AR-Q20-V108K, indicating that the mutation V-108K does not affect AR transcriptional activation (not shown).
Subcellular Localization of ARQ20 and ARQ26 To determine whether the subcellular localization of ARQ26 was altered, we examined PC3-AR-3, PC3-Q20-2, and PC3-Q26-5 cells using the AR441 antibody (Nazareth et al, 1999). In the absence of hormone, the wild-type AR (not shown), AR-Q20, and AR-Q26 (Figure 4) receptors exhibited a diffuse cytoplasmic and nuclear distribution in stably transfected PC-3 cells. Following addition of R1881 AR-Q20 and AR-Q26 (Figure 4), receptors were 100% intranuclear following 1.5 hours or 5 days of R1881 treatment (Figure 4). It is interesting that unlike AR constructs with the highly expanded glutamine repeat found in Kennedy disease (Stenoien et al, 1999), no formation of cytoplasmic or nuclear aggregates was associated with addition of hormone in PC3-Q26-5 cells. In support of these observations, transiently transfected HeLa cells yielded similar results (data not shown). Thus, these studies demonstrated that the AR-Q26 receptor was indistinguishable from the wild-type receptor with regard to its subcellular localization and morphology.
| Discussion |
|---|
|
|
|---|
Thus, mutations of AR are not early events that lead to neoplastic degeneration of prostatic tissue; rather, they are late developments that may affect biologic behavior, response to treatment, or both. This concept was confirmed in a paper by Taplin et al (1999) who identified a high prevalence of "gain-of-function" type mutations in patients who had been treated with combined androgen blockade (ie, the combination of testicular androgen blockade [surgical or chemical] with the antiandrogen Flutamide). Because these patients responded to subsequent treatment with Casodex with a lowered circulating level of prostate-specific antigen, these investigators suggested that specific types of AR mutations result from selective pressure of Flutamide treatment.
Whether the frequency of AR mutations is significant in primary tumors of patients with advanced disease (stage C and D) is a controversial issue. For instance, some series report a significant prevalence of mutations in these patients (17 in 49 cases) (Gaddipati et al, 1994; Tilley et al, 1996), whereas others have identified none (Rizeveld de Winter et al, 1994). To study the occurrence of AR mutations in the primary tumor of patients with advanced disease, and to determine whether the selective pressure of AA promotes their accumulation, we chose a group of 10 patients with stage D1 disease in which the primary cancer had been sampled before and after AA. SSCP and sequence analysis of the entire AR yielded no significant differences in 9 patients. In the 10th patient, a reproducible SSCP shift was identified in the sample obtained after AA in the second segment of exon 1, which contains the poly-Q microsatellite. Sequence analysis showed that 100% of the templates obtained before AA contained a poly-Q tract of 20 glutamines, whereas tissue obtained after AA contained a poly-Q segment of 26 glutamines in 70% of the templates and of 20 in the remaining 30% of cases. Overall, we detected one somatic mutation changing the open reading frame in the 10 samples obtained after AA, and none in those obtained before AA.
Functional Analysis of ARQ26![]()
The benign surrounding prostatic tissue of patient F analyzed as a control
showed 20 glutamines in 100% of the AR templates both before and after AA.
Thus, the presence of AR molecules containing 26 glutamines was a unique
feature of the neoplastic tissue extracted after androgen ablation. To study
whether this represents an adaptation to survive the selective pressure
created by AA, an extensive functional analysis of the ARQ26 receptor was
performed. Due to the poor quality of genomic DNA obtained from paraffin
embedded tissue, a mutation had to be inserted to recreate the AR expression
vector containing 26 glutamines (CMV-AR-Q26-V108K). To make sure that AR
function was not affected by this mutation a control expression vector with 20
glutamines and the V108K mutation was also made. The activity of this
construct was initially compared with that of our original wild-type AR
expression vector (CMV-AR; Tilley et al,
1989), and no differences were detected. Subsequently, the
activity of expression vectors CMV-AR-Q26-V108K and CMV-AR-Q20-V108K were
compared. Monolayer binding analysis of PC-3 cells stably transfected with
these constructs did not show significant differences in the affinity for
3[H]-DHT binding. This is in agreement with the binding
characteristics of the AR detected in patients with spino bulbar muscular
atrophy (SBMA; La Spada et al,
1991), which has been reported to be normal despite an expansion
of the poly-Q tract (usually to more than 41 glutamines)
(Mhatre et al, 1993).
Hormone-mediated formation of cytoplasmic and nuclear aggregates, one of the most typical feature of the SBMA ARs (Stenoien et al, 1999), was not detected in the experiments conducted with immunolabeled CMV-AR-Q26-V108K. Such studies showed that CMV-AR-Q26-V108K and CMV-AR-Q20-V108K were indistinguishable both in stably transfected PC-3 cells, and in transiently transfected HeLa cells. In particular, both constructs underwent rapid nuclear translocation upon addition of androgen to the medium (Fig. 4).
Experiments were also performed to compare the transcriptional ability of CMV-AR-Q20-V108K and CMV-AR-Q26-V108K in transiently transfected COS-1 cells. A reproducible, decreased functional activity of CMV-AR-Q26-V108K by 30%50% was detected in several experiments. This finding is in agreement with previous data in the SBMA literature in which investigators found an inverse correlation between poly-Q size and transcriptional activity (Chamberlain et al, 1994; Kazemi-Esfarjani et al, 1995). According to these investigators, decreased transcriptional activity of an AR with an expanded glutamine repeat may explain the features of androgen insensitivity that develop later in the life of patients with SBMA.
AR clones with a length of 26 glutamines were detected only in the specimen obtained after AA in patient F. This provides correlative data linking AA to selection of AR variants in a minority of prostate cancer cases. However, we realize that it is counterintuitive to correlate a functionally less active AR to survival in the androgen-depleted environment that is created by AA. In addition, it is known that epidemiological studies have linked the risk of developing prostate cancer to a shortened poly-Q repeat of AR (Irvine et al, 1995; Giovannucci et al, 1997; Stanford et al, 1997; Hakimi et al, 1998). Nevertheless, one theoretical possibility to explain our result could be that cells that carry the variant form of AR with 26Q may find alternative mechanisms to survive in the presence of a less active molecule such as AR, which in the prostate, is widely believed to have antiapoptotic and mitogenic effects. Consequently, this population of cells would find itself with a survival advantage compared with the cells that carry a wild-type AR construct in new endocrine milieu created by AA treatments.
| Conclusions |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Allgood VE, Zhang Y, O'Malley BW, Weigel NL. Analysis of chicken progesterone receptor function and phosphorylation using an adenovirus-mediated procedure for high-efficiency DNA transfer. Biochemistry.1997; 36:224 232.[Medline]
Buchanan G, Yang M, Harris JM, et al. Mutations at the boundary of
the hinge and ligand binding domain of the androgen receptor confer increased
transactivation function. Mol Endocrinol.2001; 15:46
56.
Castagnaro M, Yandell DW, Dockhorn-Dworniczak B, Wolfe HJ, Poremba C. Androgen receptor gene mutations and p53 gene analysis in advanced prostate cancer [in German]. Verh Dtsch Ges Pathol.1993; 77:119 123.[Medline]
Chamberlain NL, Driver ED, Miesfeld RL. The length and location of
CAG trinucleotide repeats in the androgen receptor N-terminal domain affect
transactivation function. Nucleic Acids Res.1994; 22:3181
3186.
Choong CS, Kemppainen JA, Zhou ZX, Wilson EM. Reduced androgen
receptor gene expression with first exon CAG repeat expansion. Mol
Endocrinol. 1996;10:1527
1535.
Craft N, Shostak Y, Carey M, Sawyers C. A mechanism for hormone-independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med.1999; 5:280 285.[Medline]
Culig Z, Hobisch A, et al. Mutant androgen receptor detected in an
advanced stage prostatic carcinoma is activated by adrenal androgens and
progesterone. Mol Endocrinol.1993; 7:1541
1550.
Culig Z, Hobisch A, Hittmair A, Peterziel H, Cato AC, Bartsch G, Klocker H. Expression, structure, and function of androgen receptor in advanced prostatic carcinoma. Prostate.1998; 35:63 70.[Medline]
de Vere White R, Meyers F, Chi SG, et al. Human androgen receptor expression in prostate cancer following androgen ablation. Eur Urol. 1997;31:1 6.
Elo JP, Kvist L, Leinonen K, Isomaa V, Henttu P, Lukkarinen O, Vihko P. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol. J Clin Endocrinol Metab. 1995;80:3494 500.[Abstract]
Evans BA, Harper ME, Daniells CE, Watts CE, Matenhelia S, Green J, Griffiths K. Low incidence of androgen receptor gene mutations in human prostatic tumors using single strand conformation polymorphism analysis. Prostate. 1996;28:162 171.[Medline]
Fenton MA, Shuster TD, Fertig AM, Taplin ME, Kolvenbag G, Bubley GJ, Balk SP. Functional characterization of mutant androgen receptors from androgen-independent prostate cancer [in process citation]. Clin Cancer Res. 1997;3:1383 1388.[Abstract]
Gaddipati JP, McLeod DG, Heidenberg HB, Sesterhenn IA, Finger MJ,
Moul JW, Srivastava S. Frequent detection of codon 877 mutation in the
androgen receptor gene in advanced prostate cancers. Cancer
Res. 1994;54:2861
2864.
Giovannucci E, Stampfer MJ, Krithivas K, et al. The CAG repeat
within the androgen receptor gene and its relationship to prostate cancer
[published erratum appears in Proc Natl Acad Sci U S A 1997;94:8272].
Proc Natl Acad Sci U S A.1997; 94:3320
3323.
Gregory CW, He B, Johnson RT, Ford OH, Mohler JL, French FS, Wilson
EM. A mechanism for androgen receptor-mediated prostate cancer recurrence
after androgen deprivation therapy. Cancer Res.2001; 61:4315
4319.
Hakimi JM, Schoenberg MP, Rondinelli RH, Piantadosi S, Barrack ER. Androgen receptor variants with short glutamine or glycine repeats may identify unique subpopulations of men with prostate cancer. Clin Cancer Res. 1997;3:1599 1608.[Abstract]
Hobisch A, Culig Z, Radmayr C, Bartsch G, Klocker H, Hittmair A.
Distant metastases from prostatic carcinoma express androgen receptor protein.
Cancer Res.1995; 55:3068
3072.
Hobisch A, Culig Z, Radmayr C, Bartsch G, Klocker H, Hittmair A. Androgen receptor status of lymph node metastases from prostate cancer. Prostate. 1996;28:129 135.[Medline]
Hobisch A, Eder IE, Putz T, Horninger W, Bartsch G, Klocker H,
Culig Z. Interleukin-6 regulates prostate-specific protein expression in
prostate carcinoma cells by activation of the androgen receptor.
Cancer Res.1998; 58:4640
4645.
Irvine RA, Yu MC, Ross RK, Coetzee GA. The CAG and GGC
microsatellites of the androgen receptor gene are in linkage disequilibrium in
men with prostate cancer. Cancer Res.1995; 55:1937
1940.
Isaacs J, Lundmo P, Berges R, Martikainen P, Kyprianou N, English
H. Androgen regulation of programmed cell death of normal and malignant
prostatic cells. J Androl.1992; 13:457
464.
Kazemi-Esfarjani P, Trifiro MA, Pinsky L. Evidence for a repressive
function of the long polyglutamine tract in the human androgen receptor:
possible pathogenetic relevance for the (CAG)n-expanded neuronopathies.
Hum Mol Genet.1995; 4:523
527.
Koivisto P, Kononen J, Palmberg C, et al. Androgen receptor gene
amplification: a possible molecular mechanism for androgen deprivation therapy
failure in prostate cancer. Cancer Res.1997; 57:314
319.
Kousteni S, Bellido T, Plotkin L, et al. Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell.2001; 104:719 730.[Medline]
La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature.1991; 352:77 79.[Medline]
Makridakis N, Ross RK, Pike MC, et al. A prevalent missense
substitution that modulates activity of prostatic steroid 5alpha-reductase.
Cancer Res.1997; 57:1020
1022.
Marcelli M, Haidacher SJ, Plymate SR, Birnbaum RS. Altered growth and insulin-like growth factor binding protein-3 (IGFBP-3) production in PC3 prostate carcinoma cells stably transfected with a constitutively active androgen receptor cDNA. Endocrinology.1995; 136:1040 1048.[Abstract]
Marcelli M, Ittmann M, Mariani M, et al. Androgen receptor
mutations in prostate cancer. Cancer Res.2000; 60:944
949.
Marcelli M, Tilley WD, Wilson CM, Griffin JE, Wilson JD, McPhaul
MJ. Definition of the human androgen receptor gene permits the identification
of mutations that cause androgen resistance: premature termination codon of
the receptor protein at amino acid residue 588 causes complete androgen
resistance. Mol Endocrinol.1990; 4:1105
1116.
McGuire W, Chamness G, Fuqua S. Estrogen receptor variants in
clinical breast cancer. Mol Endocrinol.1991; 5:1571
1577.
McPhaul MJ, Marcelli M, Tilley WD, Griffin JE, Isidro-Gutierrez RF, Wilson JD. Molecular basis of androgen resistance in a family with a qualitative abnormality of the androgen receptor and responsive to high-dose androgen therapy. J Clin Invest.1991; 87:1413 1421.
Mhatre AN, Trifiro MA, Kaufman M, Kazemi-Esfarjani P, Figlewicz D, Rouleau G, Pinsky L. Reduced transcriptional regulatory competence of the androgen receptor in X-linked spinal and bulbar muscular atrophy. Nat Genet. 1993;5:184 188.[Medline]
Migliaccio A, Castoria G, Di Domenico M, et al. Steroid-induced androgen receptor-oestradiol receptor beta-Src complex triggers prostate cancer cell proliferation. EMBO J.2000; 19:5406 5417.[Medline]
Miyamoto H, Yeh S, Wilding G, Chang C. Promotion of agonist
activity of antiandrogens by the androgen receptor coactivator, ARA70, in
human prostate cancer DU145 cells. Proc Natl Acad Sci U S
A. 1998;95:7379
7384.
Nasu Y, Timme T, Yang G, et al. Suppression of caveolin expression induces androgen sensitivity in metastatic androgen-insensitive mouse prostate cancer. Nat Med.1998; 4:1062 1064.[Medline]
Nazareth LV, Stenoien DL, Bingman WE III, et al. A C619Y mutation
in the human androgen receptor causes inactivation and mislocalization of the
receptor with concomitant sequestration of SRC-1. Mol
Endocrinol. 1999;13:2065
2075.
Nazareth L, Weigel N. Activation of the human androgen receptor
through a protein kinase A signaling pathway. J Biol
Chem. 1996;271:19900
19907.
Newmark JR, Hardy DO, Tonb DC, Carter BS, Epstein JI, Isaacs WB,
Brown TR, Barrack ER. Androgen receptor gene mutations in human prostate
cancer. Proc Nat Acad Sci U S A.1992; 89:6319
6323.
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of
polymorphisms of human DNA by gel electrophoresis as single-strand
conformation polymorphisms. Proc Natl Acad Sci U S A.1989a; 86:2766
2770.
Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics.1989b; 5:874 879.[Medline]
Papandreou CN, Usmani B, Geng Y, et al. Neutral endopeptidase 24.11 loss in metastatic human prostate cancer contributes to androgen-in-dependent progression. Nat Med.1998; 4:50 57.[Medline]
Paz A, Lindner A, Zisman A, Siegel Y. A genetic sequence change in the 3'-noncoding region of the androgen receptor gene in prostate carcinoma. Eur Urol.1997; 31:209 215.[Medline]
Ross RK, Pike MC, Coetzee GA, et al. Androgen metabolism and
prostate cancer: establishing a model of genetic susceptibility.
Cancer Res.1998; 58:4497
4504.
Ruizeveld de Winter JA, Janssen PJ, Sleddens HM, Verleun-Mooijman MC, Trapman J, Brinkmann AO, Santerse AB, Schröder FH, Van-der-Kwast TH. Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am J Pathol.1994; 144:735 746.[Medline]
Sadi MV, Walsh PC, Barrack ER. Immunohistochemical study of androgen receptors in metastatic prostate cancer. Cancer. 1991;67:3057 3064.[Medline]
Shiao Y-H, Buzard G, Weghorst C, Rice J. DNA template as a source of artifact in the detection of p53 gene mutations using archived tissue. Biotechniques.1997; 22:608 612.[Medline]
Shoenberg MP, Hakimi JM, Wang SP, Bova GS, Fischbeck KH, Isaacs WB, Walsh PC, Barrack ER. Microsatellite mutation (Cag(24->18)) in the androgen receptor gene in human prostate cancer. Biochem Biophys Res Commun. 1994;198:74 80.[Medline]
Southern PJ, Berg P. Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J Mol Appl Genet.1982; 1:327 341.[Medline]
Stanford JL, Just JJ, Gibbs M, Wicklund KG, Neal CL, Blumenstein
BA, Ostrander EA. Polymorphic repeats in the androgen receptor gene: molecular
markers of prostate cancer risk. Cancer Res.1997; 57:1194
1198.
Stenoien DL, Cummings CJ, Adams HP, et al. Polyglutamine-expanded
androgen receptors form aggregates that sequester heat shock proteins,
proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone.
Hum Mol Genet.1999; 8:731
741.
Suzuki H, Akakura K, Komiya A, Aida S, Akimoto S, Shimazaki J. Codon 877 mutation in the androgen receptor gene in advanced prostate cancer: relation to antiandrogen withdrawal syndrome. Prostate. 1996;29:153 158.[Medline]
Suzuki H, Sato N, Watabe Y, Masai M, Seino S, Shimazaki J. Androgen receptor gene mutations in human prostate cancer. J Steroid Biochem Mol Biol. 1993;46:759 765.[Medline]
Tan J, Sharief Y, Hamil KG, et al. Dehydroepiandrosterone activates
mutant androgen receptors expressed in the androgen-dependent human prostate
cancer xenograft CWR22 and LNCaP cells. Mol
Endocrinol. 1997;11:450
499.
Taplin ME, Bubley GJ, Ko YJ, Small EJ, Upton M, Rajeshkumar B, Balk
SP. Selection for androgen receptor mutations in prostate cancers treated with
androgen antagonist. Cancer Res.1999; 59:2511
2515.
Taplin M-E, Bubley GJ, Shuster T, Frantz M, Spooner A, Ogata G, Keer H, Balk S. Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med.1995; 332:1393 1398.[Medline]
Thigpen AE, Davis DL, Milatovich A, et al. Molecular genetics of steroid 5 alpha-reductase 2 deficiency. J Clin Invest.1992; 90:799 809.
Tilley W, Buchanan G, Hickey T, Bentel J. Mutations of the androgen
receptor gene are associated with progression of human prostate cancer to
androgen independence. Clin Cancer Res.1996; 2:277
285.
Tilley WD, Lim-Tio SS, Horsfall DJ, Aspinall JO, Marshall VR,
Skinner JM. Detection of discrete androgen receptor epitopes in prostate
cancer by immunostaining: measurement by color video image analysis.
Cancer Res.1994; 54:4096
4102.
Tilley WD, Marcelli M, Wilson JD, McPhaul JM. Characterization and
cloning of a cDNA encoding the human androgen receptor. Proc Natl
Aca Sci U S A. 1989;86:327
331.
Tilley WD, Wilson CM, Marcelli M, McPhaul MJ. Androgen receptor
gene expression in human prostate carcinoma cell lines. Cancer
Res. 1990;50:5382
5386.
Van-der-Kwast T, Tetu B. Androgen receptors in untreated and treated prostatic intraepithelial neoplasia. Eur Urol.1996; 30:265 268.[Medline]
Van-der-Kwast TH, Schalken J, Rizeveld de Winter JA, Van-Vroonhoven CCJ, Mulder E, Boersma W, Trapman J. Androgen receptors in endocrine-therapy resistant human prostate cancer. Int J Cancer.1991; 48:189 193.[Medline]
Veldscholdte J, Ris-Stalpers C, Kuiper GGJM, et al. A mutation in the ligand binding domain of the androgen receptor of LnCAP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun.1990; 173:534 540.[Medline]
Visakorpi T, Hyytinen E, Koivisto P, et al. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet. 1995;9:401 406.[Medline]
Voeller H, Wilding G, Gelmann E. v-rasH expression confers
hormoneindependent in-vitro growth to LnCAP prostate carcinoma cells.
Mol Endocrinol.1991; 5:209
216.
Wang C, Uchida T. Androgen receptor gene mutations in prostate cancer [in Japanese]. Nippon Hinyokika Gakkai Zasshi.1997; 88:550 556.[Medline]
Watanabe M, Ushijima T, Shiraishi T, Yatani R, Shimazaki J, Kotake
T, Sugimura T, Nagao M. Genetic alterations of androgen receptor gene in
Japanese human prostate cancer. Jpn J Clin Oncol.1997; 27:389
393.
Wen Y, Hu MC, Makino K, Spohn B, Bartholomeusz G, Yan DH, Hung MC.
HER-2/neu promotes androgen-independent survival and growth of prostate cancer
cells through the Akt pathway. Cancer Res.2000; 60:6841
6845.
Yeh S, Chang C. Cloning and characterization of a specific
coactivator, ARA70, for the androgen receptor in human prostate cells.
Proc Natl Acad Sci U S A.1996; 93:5517
5521.
Yeh S, Lin HK, Kang HY, Thin TH, Lin MF, Chang C. From HER2/Neu
signal cascade to androgen receptor and its coactivators: a novel pathway by
induction of androgen target genes through MAP kinase in prostate cancer
cells. Proc Natl Acad Sci U S A.1999; 96:5458
5463.
Yeh S, Miyamoto H, Shima H, Chang C. From estrogen to androgen
receptor: a new pathway for sex hormones in prostate. Proc Natl
Acad Sci U S A. 1998;95:5527
5532.
Zhang Y, Bai W, Allgood VE, Weigel NL. Multiple signaling pathways
activate the chicken progesterone receptor. Mol
Endocrinol. 1994;8:577
584.
This article has been cited by other articles:
![]() |
R. M. Attar, M. Jure-Kunkel, A. Balog, M. E. Cvijic, J. Dell-John, C. A. Rizzo, L. Schweizer, T. E. Spires, J. S. Platero, M. Obermeier, et al. Discovery of BMS-641988, a Novel and Potent Inhibitor of Androgen Receptor Signaling for the Treatment of Prostate Cancer Cancer Res., August 15, 2009; 69(16): 6522 - 6530. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Shariat, D. J. Lamb, R. G. Iyengar, C. G. Roehrborn, and K. M. Slawin Herbal/Hormonal Dietary Supplement Possibly Associated with Prostate Cancer Progression Clin. Cancer Res., January 15, 2008; 14(2): 607 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Duff and I. J. McEwan Mutation of Histidine 874 in the Androgen Receptor Ligand-Binding Domain Leads to Promiscuous Ligand Activation and Altered p160 Coactivator Interactions Mol. Endocrinol., December 1, 2005; 19(12): 2943 - 2954. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |